Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9328  (registered. 2003)
Contig Information
Length 766 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Homology (BLAST) Top Hit Os08g0500000 [Oryza sativa (japonica cultivar-group)] >gi|42407349|dbj|BAD08810.1| putative COP9 complex subunit 6 [Oryza sativa Japonica Group] >gi|89267201|emb|CAJ81251.1| COP9 signalosome subunit 6 [Oryza sativa] >gi|113624121|dbj|BAF24066.1| Os08g0500000 [Oryza sativa (japonica cultivar-group)] >gi|215764935|dbj|BAG86632.1| unnamed protein product [Oryza sativa Japonica Group]
Score 604
Evalue 8.3925e-61
Total Hit Count 170
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9328
GATGGGGGCCCCCAGCTCATCTTTGTCAAATCAAATTACACAATTGAGACCGTAGAAGCAGAGAGGATATCTGTAGATCATGTTGCCCATCTGAAACCAT
CTGATGGTGGCTCTGCAGCAACTCAATTGGCTGCTCATCTTACAGGAATACACAGTGCCATCAAGATGCTCAATAGCAGGGTTCGTGTTATCCAGCAATA
CCTTGGTGCCATGCAAAAGGGTGATATCCCACTGGATAATTCACTTCTTAGGCAAGTCTCAAGCCTCGTAAGAAGACTACCAGCTATGGAATCAGAGAAA
TTCCAAGATGACTTCTTAACGGAATACAATGACACCCTCCTCATGACTTACCTTGCAATGTTCACGAACTGTTCAAGCACAATGAACGAGTTGGTCGAGA
AATTTAACACCACCTATGAGAGATCCCCTGCCAGGAGAGGAGGCCGAGGCGCTTTCATGTAGATGGGTTCCAGCCGTCCTGCTGCTGCTGAGGTTTTGGT
GCTGGTTATCCATGCTGCTGAGATTTTGAAAATAGTTCTCATATCTAGACGCAATTTTTGCGTGCAATCAGTTAGGTGCTCTATCTTCCGGCAGTATCCG
AGACTTTTCAATCTTCTTATCCTCTCTGGGTTGGATCAGTGACACGACGTGCCTGGGATGATTGATTATCCTCTTGTCCTGAAGTTGACATGTAAAGTTC
GGCTTAATAGATGTTGCTCAAGTTAACTCGTATATCGGTCTTATCCTGCCTTTTTGAAAAAAAAAA
page-top