Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6275  (registered. 2012)
Contig Information
Length 687 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 6
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_SP 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226499608|ref|NP_001148387.1|| LOC100282000 [Zea mays]
Score 186
Evalue 1.00E-45
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6275
GCACGAGGCAGCAATCGAACACACACTCCTCCCGGCTCCCTCCAATGGCGCTCCTCGCTGTCCAGGGCATGGCCATGTCCACGGCCGCCTTCCCCTCGCA
CCACCACGGCGCCGTAGCCTCCTCCTCCTTCGGGCTCTCAGCCGCCGTATCTTTCTCCCGCTCCCGCACCAGCCTCGTCGCCACCGCGGTCTTGGCTCCT
CTCACATCAGTTCTTGATGTCTACTGTGGAAGAGGGGACAGAAAGACGAAGAGAGGCAAAAGGTTCAGCCACTCATATGGGAATGCACGGCCCCGTAACA
AGAAGAAGGGAACAGGCCCAGCACGGCTTTACGCCCCTCCAGCGCCTCCTAGGAAGGATCAGTTTGAGGATGGGGAGATCATCGCAATTGAGATTGATGA
TGACATCATGGAAAGGATGGATTAGGATGTCTGAATTTTCCCTTTATTTCATGATTTCCTGTCCTTTCTGAAATACAATGCCCTCGGAGTAATTATTTTG
CCATTATCCTATGTGAAGTGCAATTTCTTAGAAGTAATTATTTGGTCTTTCGGGACAAAACACAGATGCATATGTGCTTTCGATTGCTTAGGCTGTATGC
ATAGGGAACCTGGTACCTATGTTGTCTAGCTCTACCGATGAGCCGGGGCCAGTGCTTCTAAAATATGTCTGTTTTTTCTAAAAAAAA
page-top