Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9082  (registered. 2003)
Contig Information
Length 760 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Homology (BLAST) Top Hit blue copper-binding protein [Dasypyrum villosum]
Score 586
Evalue 1.00923e-58
Total Hit Count 459
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9082
ATCCTCTGCTTTGCATTCCTCCTTCCAGTTCCAACCGCAATCAATGGCCGCCATGAAGATCACTCTCCTTGCCGTGGCCACAATCTCGGCAGTCTTACTG
GGCACCGCGTCGGCGGCGACCTACGGTGTTGGCGAGCCGGGCGGTTCGTGGACCCTCAACACCGACTACAGCAACTGGGTGTCCAACAAGAAGTTCCACC
CGGGTGATGAGATCATCTTCAAGTACTCCCCCGCGGCGCACGATGTGGTCGAGGTCAGCAAGGCTGGCTACGACTCCTGCAGCACCGCCAGCGCCATCAA
CACCTTCAAGTCCGGCAACGACGTCGTCCCCCTCAACGCCACCGGCACCCGCTACTTCATCTGCGGCATCACTGGCCACTGCAGCCCCACCGCCGCCGCC
AGCATGAAGGTCGTGATCGACGTCGTCCCGAGTTCCTCCTCACCGTCGTCACCCATGCCGGCTGCCGGTCCGGACGCGAGCAACCCGCCGCCACCCTCCT
CTACCGCATCCTCTGTCGGGGCCACAGCAGGATTTGGCCTTGTCGTCCTACTGGTCGCCAGTCTCATGGTTTAAAATGCATATTTCAGCCAGCTGCATGC
CGCACGCACATATGAGCTTACATATTGTTTGACTGGTTATTACTGGGGAATACATACATGTATTATTGCTTAGAGCGAAGATGTGAGAACTACTTTGTAA
GTTTGTATCTCTCACGTTTGTATGTAATCTACTGGCCTTTAGGCATTTCATATGATTTTG
page-top