Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig8975  (registered. 2003)
Contig Information
Length 838 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit OSJNBa0033G16.1 [Oryza sativa (japonica cultivar-group)]
Score 86
Evalue 1.14508
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig8975
GGAGCCTCCGCCGTCGCTCCTCCTCCCCAGCTCTCTAATCTCACCGCATCCCTCTTCTCCCTGCCCCGAGCCATCGCTGCAACCCCTCCTCCTTCCTAGG
TTTCTCCTTGACACCTCATGACTCCCCGCCACCTCTTTCTAAGCGGCGATGACCAGTGGGATTGGAGGCGGCAGCTCGCGCGGTGGGGAAAGAGGACCGT
GCTGGGAAGAAATCTCGCGGCGGCCGACGGCCAGCTCATATGGTGGGGACGGAGGTCGCCGGAGAGGAGGTGATTTGGGGGTGGCATGTCGCCCTTCGAG
CTGTGATCTGCCGTGGCTCCATTCGCATCTCCGGAGACGGTGTGTGTTGCCTTCGCTATGTATTACTCCCTCCGTTCCAATGTGGATGTATCTATACTTG
TTTAGTGTCTAAATATATTCATGTCTAGACAAATGGGAGTCAACTAATTTGGAACGGAGGGAGTACAAACGATAGGTGGTTAATTTTGCAGGAGTGCCTC
GCTTCATATTGTGCGCTTGTGTGATTTGGGGTACCGTTGGGGAGGGCTTCTTTCCTTCCATTTTTAGGTTGCTGCCTTCTGTTCTACTCCCTCTGTTCCC
AAATGTAAGTCTTTTTAGAGATTTCAACAAGGGACTATATACGGAGCAAAATAAGTGAATCTACACTTTAAAATATGTCTATATACATCTGTACGTTGTG
GTTCATTTGAAATCTCTAAAAAGACTTATATTTAGGAACGGAGGGAATATTATTGTGGTCATGTGTGTGTCGTGCTCTTTTCCAGGTTAGATCGATGGAA
CTAGCAAGGTCACACATAGAGTTGAAATCAGGGGCAAA
page-top