Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig8801  (registered. 2003)
Contig Information
Length 397 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit hypothetical protein HS_1384 [Haemophilus somnus 129PT] >gi|112823570|gb|ABI25659.1| Haemophilus-specific protein, uncharacterized [Haemophilus somnus 129PT]
Score 80
Evalue 1.55965
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig8801
ACAGTAAATAAAACAGAGCACAAAGCAGTAGCCTTTGGAGCAGGTTACAGTTTGCACTTGGTGTTAAAGGATTTGGAGCAGGCTATATCTGTGATGACAC
AGATTGGTTATGCAGGATCTCTTGGCTAAATCCTTCTGCTTTATCATGAGGACAACAAATAGTAACAAATAGTGGTTACTTCTCATCTGAGCTTGAGCTG
TGGTGAATGCGACCGATGTTTCTACGAAGATGTAGTTCTTTTGGTTTATCGACTAATATTATCGTATATAGACGTGATGCCTGAGGCGTTTTGAATCAGT
GTCGTAGCAGACTGCCCTATCCTTATTGTAAATTATGTGTGATCACCGACAGTCCTTCAGGTCGATTTACCACTCCATGGTTATTGTAAAAAAAAAA
page-top