Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6221  (registered. 2012)
Contig Information
Length 1987 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_CSEC Callus 2
Wh_OKCS Seed DPA5 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|219888447|gb|ACL54598.1|| unknown [Zea mays]
Score 1117
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6221
CACCACCCGGCCCAAGCCCAATCCCCTGTGGTGCCTTTACCTCGTTCTCCGGTTCCCCGTCCCATTCCATCCACCGCGTCCAGACACAATCTTACCGGCG
ACGCCTCGCGACCTCCTCAGCTCCTCCCCCCCTTCGCCGCCGCTGCCACCGCGGGGACCCGCTCTGATCCCGTCAGTTGTAGAAGTAACTGATTAGCCTG
ATGGCTATGGTCGATGAGCCTCTCTATCCAATTGCCGTGCTGATAGATGAGCTTAAAAATGAAGATATTCAATTGCGCCTGAACTCCATCAGAAGACTTT
CCACTATTGCACGGGCACTTGGAGAAGAAAGAACCAGGAAGGAACTGATTCCTTTCCTCAGCGAAAACAATGATGATGAAGATGAGGTGCTTCTTGCAAT
GGCTGAAGAATTGGGTGTGTTCATTCCTTATGTTGGGGGTGTAGAGCATGCTCATGTTTTGCTCCCACCATTGGAGACATTGTCTACGGTGGAGGAAACC
TGTGTCCGAGACAAAGCAGTTGAGTCGTTGTGCCGTATTGGTGCACAGATGAAAGAAAATGACATTGTTGACTATTTCATTGCAGTAGTAAAGAGGCTAG
CGGCTGGTGAGTGGTTTACAGCTAGAGTATCATCCTGTGGTCTTTTCCATATAGCCTATCCAAGTGCCACCGATCCGTTGAAAACAGAACTGAGGACTAT
TTATGGCCAGTTATGCCAAGATGACATGCCTATGGTCAGAAGGGCAGCTGCATCAAATCTTGGGAAGTTTGCTGCCACTGTTGAACAGAGCCATTTGAAG
ACAGAAATCATGTCGATCTTTGATGATCTTACCCAAGATGATCAAGATTCAGTACGTTTATTGGCAGTTGAAGGCTGTGCCGCTCTTGGAAAATTGTTAG
AACCCCAAGATTGTGTAGCCCATATCCTTCCAGTCATTGTTAATTTCTCCCAGGATAAATCTTGGCGTGTCCGTTATATGGTTGCAAACCAGTTGTATGA
GCTCTGCGAGGCAGTTGGTCCTGAGCCTACAAGAGCAGACCTGGTGCCTGCATATGTTCGCCTCCTCCGTGATAATGAGGCTGAAGTGCGGATAGCAGCT
GCCGGAAAAGTTACTAAGTTCTGTAGGATATTAAGTCCACAGCTTGCAATTCAGCACATTCTGCCGTGTGTTAAGGAATTGTCATCAGATTCGTCTCAGC
ATGTTCGCTCAGCTTTGGCTTCAGTCATCATGGGAATGGCCCCTGTCTTGGGGAAGGATGCTACCATTGAACAACTTCTTCCTATTTTTCTTTCTTTGCT
GAAGGATGAATTTCCTGATGTTCGACTCAACATAATCAGCAAGCTTGATCAAGTTAATCAGGTCATTGGAATTGACTTGCTGTCGCAATCTCTATTGCCG
GCTATTGTAGAACTTGCGGAGGATAGGCACTGGAGGGTTCGCCTTGCAATAATTGAGTACATCCCTCTGCTGGCTAGTCAGTTAGGTGTTGGGTTTTTTG
ATGACAAGCTGGGGGCACTTTGCATGCAATGGTTGGAAGATAAGGTTTTCTCGATCAGAGAAGCTGCCGCAAACAACTTGAAGCGCCTGGCGGAGGAGTT
TGGTCCAGAGTGGGCAATGCAACATATAATTCCTCAGGTGTTGGAGAAGATAAACAACCCACATTATCTGTATCGCATGACCATCCTGCAAGCTATCTCA
TTGCTAGCCCCTGTCATGGGTGCAGAAATAACATGCCAAAAGCTGCTCCCTGTTGTCATTAATTCCTCGAAGGACAGAGTGCCGAACATCAAATTCAATG
TTGCGAAAGTTCTGCAGTCGCTTGTACCAATCCTTGATCAATCTGTCGCTGAGAAGACTGTGAAGCCATGCCTTGTCGAGCTGAGCGAGGACCCTGATGT
GGATGTACGATACTATGCAAACCAGGCCCTTCNNNCGTGTGACCAGATCATGATGTCTAGCTAACTAAGCTACTGTCGTCACGTTCT
page-top