Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6207  (registered. 2012)
Contig Information
Length 771 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_EM Dormant seed with water absorption 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_SP 4
WH_XA Root 6
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242047002|ref|XP_002461247.1|| hypothetical protein SORBIDRAFT_02g043510 [Sorghum bicolor]
Score 298
Evalue 6.00E-79
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6207
ATATTTTCCTCCCTGTCGCCCTCCCTTTCCTCCACTCGCGCTTCGCTCTCAGATCCCTTCTCCTCCGTCTCGCCCGCGTGTTGGGATAGGAGCCATGGCG
GACCAGCTCACCGACGACCAGATCGCCGAGTTCAAGGAGGCCTTCAGCCTCTTCGACAAGGATGGAGACGGCTGCATCACCACCAAGGAACTTGGAACTG
TGATGCGCTCGCTGGGGCAGAACCCCACTGAGGCAGAGCTTCAGGATATGATCAATGAAGTGGATGCTGATGGCAATGGAACGATTGACTTTCCTGAGTT
CCTTAACCTGATGGCACGTAAGATGAAAGACACCGACTCCGAGGAGGAGCTTAAGGAGGCTTTCCGTGTGTTTGACAAGGACCAGAATGGTTTCATCTCG
GCAGCTGAACTCCGCCATGTCATGACCAACCTTGGTGAGAAGCTGACAGACGAGGAGGTGGATGAGATGATCCGTGAGGCTGATGTCGATGGTGATGGCC
AGATCAATTACGAAGAGTTTGTGAAGGTGATGATGGCCAAGTGAGCTGCCATACTAAGCTAGTTCTATCTCGATGTTAGCAGCTAGTTTAGCCTTGAAAA
CTGACAGCACTTGGTACTACTGTTAAGTCCAGTGAATGAACATATTGCTCGCTCTTCCTTTCTTCTCAGGGATGTTGAGAATTTCGTTTGGATTTTCCTG
CAGTTGTATTACCTTTGTACAATGTAGCTTTCTTTCCAAATTGAGATCATGAATTTGCTGTAAAAAAAAAA
page-top