Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6200  (registered. 2012)
Contig Information
Length 1028 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_CA 1
WH_SP 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115478555|ref|NP_001062871.1|| Os09g0323500 [Oryza sativa (japonica cultivar-group)]
Score 530
Evalue 1.00E-148
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6200
CTTTGTTGTTGTTGTTATATGTATTCAACAATTTGACTTGAGCTGTCTCTGAATGGATAGATCCGCATACAGTAAATAATTTAATCGCCATAATTAGAGA
TCATTATGTGATCTTAAAGCGCAACTGTGGAAATAACAGCATGCACAATGGTAGCTATTCATTCTTTCTTCCTATTTGAGGCTCCCGCCTTTAGGTGCGC
ATTGGCAATTCTATCTGGTAATGCACTGTGTGGTTCTTCCATATACCACTCTCGAGGTACTTCTCATATAAGCTAGCTTCTCCATCATAGTTCACTGAAA
GAACTGCTGTGCTCCTTGTCCCATAGAGCCCTTCGTCAGTTTGCACCTCGATGAAGATGGAGCTCAGACCGTGCTCCCAGTTGGGATCACAACCGGTGTT
TGGCAGCCTATCTTTATCAGCCCTCGTGGTGTCAGTCATTAGTCTGTCAGCTATATCCTTCGCTTCAACTTCATCATCACCATGCTTCCTTATAAACTCC
CTGAAGTTTTTACCAAGGCGAATTGCCTTCTGCCAAGGGCTGTCTAGCCTTGCATTGGACAACACATGGAGTCCTGGTGAGACGAGCTGAATCGTCGCAG
GCTGCCCCTTTGGCCGGTTTGACACATAAACCATGACATTCCTGGTTAGATCAGCTAGTATAAGGTTGAAGCCATTGTACTCATCAGCTTCTTTTGCGAC
TTCAGTTGCAACCTCCAGTGGGCTCTTGTTGCCCTGCAGGAACCTGAGGGGCAGGTCTCCCCTAGTGCGTGCGCCAGGCATCACATCAGGCTCGAGCACA
TTGGTCAGGAAGGCAAGTCTGCCATCTTTGGTGCTCCCCATCCATGTTCCTCCACCAAGTACATCCCTGCCACCAAGAATCTTCATTGAGCCCTCCCCCC
ACCATCCTACTGCCTTTGTAGGCCTGCTATGGAACTCATCTCTGTTGAGCAGCAGCAGGAGCTGGTGCTGAGGGTGAGCCTGCCAAATCCATGCAGCGAT
ACACATGGCTTCAGGTGGTTCCTTACTC
page-top