Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6196  (registered. 2012)
Contig Information
Length 846 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 3
Wh_yd Spikelet at late flowering 10
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 2
WH_SP 5
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|471319|emb|CAA54065.1|| HvB12D [Hordeum vulgare subsp. vulgare]
Score 169
Evalue 3.00E-40
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6196
TCCCCGCGACTCCGATGGCCAGCAAGTGGGTCAGGCNNNAGGTGTACCCGCTGTTCGCGGCGACGGGCGTGGCCATCGGCATCTGCGCCTTTAGCCNNNN
NCGCAACATCACCGGCAACCCAGAAGTCAGGGTCAACAAGATGGGGAGGGCAGCGGGAGTGCTTGAGAACCATGAGGAGGGCAGGCGCTACGCCGAGCAC
GGCCTCAGAGCTTATGTGCAGGACAAGACCCCCGAGATCATGCCAGGAATCAACAAGTTCTTCACCAGCCCAAAATGAAGCACTTTAGTCTGTCTGTGAC
TCGCTATTAGTAACTGTTGTGGTCAAGTGCAAACCTATTTCAAGCATTCAGTAATGTTGTTGCGTCCATAATTCAGAGGACATCGTCAATTACCTCTTAT
TGAAAGAACCATGTGATGTTTGATGGCTTGCTATATATGTGATGGTTGATGGCTTGTTCGTCCACACACTCCCGCCGCCACCACCGCCGCGAACCGGAGA
GCGAGGCCGACACCGCCGCCGCGATGAGGGCCAAGTGGAAGAAGAAGAGGATGAGGAGGCTCAAGAGGAAGCGCCGAAAGATGAGGCAGCGATCCAAGTA
GGCCGTAAGCATCATCTTGCATCCAGGCAGCGGAACTCTGAGGGGTGATGGCATTGTCTAGTGATTCTTGATTTGTTCTGTTGTTTTGGCTGTGGAAGTT
GCTTTTACCTGTGTTTGGTCAAATTTAGTTGTTTAATACTAGTCTGGCTATGTTCCAGTACTGAGTTTTATGTAATGTGAGGATTATATGTGTTTGTGAC
TGAATTTTATGCACCTATTATCCTTGAGGTACTAAAAAAAAAAAAA
page-top