Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig619  (registered. 2012)
Contig Information
Length 672 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 2
Wh_OKCS Seed DPA5 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|2583072|gb|AAB82604.1|| ADP-glucose-pyrophosphorylase large subunit [Triticum aestivum]
Score 266
Evalue 2.00E-69
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig619
TTTTTTTTTTACCTCAACACACAGCCTCTTCTTATTTATTACAGGGGCAAAACGAACGACTATTACTTTGTTCCACTGCTACTTACTACTTACTACTTAC
TACTGATGCTGCCTGCGCGCGCCTCCACTTTCAGTCTCAGCCATTCAAAGCTTCAAACGGCCCCCGTCCCCGGGTCACTCCTCCAGTCCCGGCCCCGAGA
AGCCGACGACAACGATCAGCGCAGCGCAGAGGTTGTCGCGGAACCCCGTCGCGCCGGCCCGGCGGCGCTCTACACGACGGTGCCGTCCTTGATGGTCGCG
TTCTTCTGGATCACCACGATCCCGGACCTGATGTAGTACCCCTCCTCCGGCCTGTCGGCTTCTTGCACTCCCTCCTTGTTTGAGATGACCACGTCCCTTC
CTATCCTCGCGTTCATGTCGATGATGCAGTTGCTGATCTTTGTGTTCTCCCCGACGCCGATGGGGACCTTGCCCTCCGACATCAGCCTCGAGATCTCGTC
TTCGGTCTCGTACGAGTCCGCGCCCATCATCATCGCATTCTTGAGCTCGCTTCCGGAGTTTAGGCGTGAGCGAACGCCGATGATGGAGTGCTCGATTTTG
CATTCACGCAAGAAGCAGCCGTGCGAAATGATCGCTTCTTTGATCCTGCACTTGTCTGACTTTGTTGGTGGC
page-top