Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig8350  (registered. 2003)
Contig Information
Length 501 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit Pc21g07090 [Penicillium chrysogenum Wisconsin 54-1255] (no hit)
Score 94
Evalue 0.0807943
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig8350
CACCCCCCCTCTTCCTACATTGGTTTGTTTGTTGCGTTCTTTCTCAGGAGATATGCTGCAGCATTAATAACATCTACAGTGATACACATGTTACACTGAT
GAGATGATTGTCATCGGCTGGCTGCATCTTTCGATCCTGGTTGGCATAAGCTGAAGCTAGCATGTCAACATGGAGGACAGTTTTTGCCAAATCTTCAAAC
TAAACGAGAGATGGCCTGAAGCTACTTGCAGAAGTGTCTTTATCTATCTATCCGGGCTTGACCTACTTGCTGCACGGTATTGGTAGGGCGCCCTGTATTA
AAGCGACTTGTCTTCACTATAGTTTGCCTAGTTGTTGGTCCGGAAAAGCAGATGGGATACGGTACCGCATACCCACCCGGTTTGGATGTGGTTTAATTAG
GACTTGTTGCTGTCTTTGGACAAGACTTTTTACCTACTGTTTATTAATGGGTGTGACCTGCACCACCGCCACCGGGCAATTTGCATCGAATAAAAAAAAA
A
page-top