Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6148  (registered. 2012)
Contig Information
Length 1448 bp
Clones alternative view 119 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 4
Wh_oh Pistil at heading date 7
Wh_r Root 10
Wh_yd Spikelet at late flowering 7
Wh_CSEC Callus 7
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 6
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_SP 14
WH_XA Root 3
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23℃ 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115445597|ref|NP_001046578.1|| Os02g0287000 [Oryza sativa (japonica cultivar-group)]
Score 470
Evalue 2.00E-130
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6148
AACAAAACAGAGGACAAGTTCTATTCAAACATAAAAACACATTACAGGAATAAACTAAATATTTAGTTTTCAACTCATTACCTCCATCCAGAAAGTAACA
CGAACAAAATAAGATAGCGGAACACTGGCTAGGAATGTCGACAGAAGTACTCAAGAAATCAGCCATCAAAACTGACTACAAAGTTCACGACACCCAGGTG
GCACATATATCATCTTCTAGATATGAAGCAGCAAAATAGCAACTTCTATCCTCTACTCAGCAGCAGCAACCTCCTCTGCTCCAGGAATCACCTCATCTCC
ATCAGCAGGCCTGTCAAGCTTCACACCAACATCCTCCTTGTAGTCACCGTGAACCTCCATGAGCTTCCCCAGGTCGAACTTGGGGGCCTTCAGGATCTTC
ACCTTGCGGACGTACACGTTCTGGAGGGGGAAGATGCCTGAGGTGGCCTTCTCAATCTCCTTTCCAATCACCTCAGGGATGAACTTGTTCACAAGCTCCT
TCAAGTCACAGCTTGCAGCTTGGTTGACCATGATCTCAACCATCTTGCGGCGGATCTGTCTGATCTGACTTGCTTGGGCATAGCAAGTGCGCTTCACCTG
GTTTGGGCGTCTCTTGGTGAAGCCAATGGCGAACATGCGGAGCATGTAGTTGTCAGTGGTCTTCACATCCACATGAGCCTCAATGAGTGTCTGCCACTTC
CTCACAAGAGACCTGAGCTTGTCAGTGGTGAAGTCCATGCCCCAGAAGTTTGTGAGGACATTCATCCCTTGCACATCCTCAGCACGGAGTCTGATCTTCC
TGTAGGCCTGGTCCTCATCGTTCTGAAGATCAGCTAGAGATACTTCGAACACCCTGTGCTTCAGACCCTCTGAGGCAATCTTGGTACCCTGCGTCCTGGA
CACGAGGGTCTTGCCGACGTTGCGGCTGGTGAACAGCAGCGGCGCCTTGATGTCATACCACTGCTTCTTGGTGAACGGATCGACGGCCTTCTTCTTGCTT
CCCTTCCTCCCCTTGGAGATGCGCTTGTTCTTGCCGACCGCCATGGTTGCCGCTGCGGGTGGAGTGGCGGCGCTGCGGCGTCTGGGGGCTTGAGCGTCGG
CCTCGTGCCGAATTCGGCACGAGGAGCACTTTCCCTTAACAGGAGCAAAATGTGACAAGGCAAAGTTTTCACCAACACGATCATAAGTTATCAACTTAAA
AGTGCTGTAAACACAAAGGAACCATCCTCCTTCAACATCTAAAGGCCCGACATACTGTCTATTCCATGCAACGGCAATCTAAGACCTGGGCTTCTCCTTC
TTTTCCTTGAAGAGGGCAAGCAGAGACACACCAGACACCTTGACGACCTTGAACCGAACACCGGGAATATCTCCCACAGCATGTCCCTTACGACCGAATC
CAGCAATCAGCACCTCGTCATTCTCCTCGATGAAGTTCAGGCAACCAT
page-top