Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7947  (registered. 2003)
Contig Information
Length 1224 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit putative kinase [Oryza sativa (japonica cultivar-group)] >gi|31433008|gb|AAP54572.1| CDPK-related protein kinase, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 1187
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7947
AGAATCTTGTCCAGAGGTGGGAGGTACACTGAGGATGATGCTAAAGTTATCATCAAACAGATATTAAGTGTAGTTGCTTTCTGCCATCTTCAGGGTGTTG
TTCATCGTGATCTTAAGCCAGAGAATTTCCTATTCAGTACTAGAGATGAACATTCTCCTATGAAGCTCATCGATTTTGGCCTCTCTGATTTTATAAGGCC
AGATGAAAGGCTGAATGACATTGTTGGTAGTGCATACTATGTTGCTCCAGAAGTCCTACATAGGTCATATAGCACAGAAGCAGACATGTGGAGCGTAGGT
GTTATCACTTATATCTTGCTGTGTGGTAGCAGACCATTCTGGGCACGCACTGAATCAGGAATTTTCCGCTCTGTGCTGAGAGCTGATCCTAATTTTGACG
ATTCACCATGGGCATCAATATCTCCTGAAGCTAAAGACTTTGTCAAAAGACTTCTTAACAAGGATTACAGAAAAAGAATGACTGCTGCACAGGCACTCTC
TCACCCCTGGTTGCGAGATGAGTGCTGCCCAGTCCCTCTGGATATGCTAGTTTTTAAGCTGGTTAAGGCGCATCTTCGTTCCACACCTTTCAAACGGGCA
GCATTAAAGGCTCTGTCTAGAGCAATAACAGAAGATGAGCTTATCTATGCCAGAGCACAGTACAACTTATTACAACCAAGTAGTCAAGATGGTCGAATAT
GTATTGAGAACTTCAGGGATGGCTCTTCTACAAAACTCCACTGACGCTATGAAAGAATCTAGAACTCTTGATATCTTAAGTGCGTTGGAGCCGCTTGCAT
ATAGGAGAATGGACTTTGAGGAGTTCCGTGCGGCGACTATCAGCCCTTACCAACTTGAAGCTTCGTCTATGTGGGACGAAATAGCGAGCACCGCATTTGA
GTGCTTTGAGCAGGAAGGCAACCGTGTTATCACAATTGAGGAGCTAGCTCAGGAGATGAATCTTTCTTCTGCGGCGTATTCTATCGTCCGCGACTGGATT
AGGCCATCAGATGGGAAGCTTAGCTTTATAGGCTACACCAAATTTTTGCATGGATTGACTATGCGAAGCAGCAACGCGAGGCGCCATCACTGATCTGTTT
CGCCTCAGCTGCTTAGATTTCTTTGATTCATGGGGAGTTTGATGGATGTTGGTGTTTTATCTGTGTTTTTGGCGGTTTAGCGTTTGTAGAGAAAAAAGAA
GAAAGAAACAGAAAGTGGGAGTCA
page-top