Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7944  (registered. 2003)
Contig Information
Length 855 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit cystatin WC-4 [Triticum aestivum] >gi|82503161|gb|ABB80382.1| cystatin WC-4 [Triticum aestivum]
Score 263
Evalue 3.58913e-21
Total Hit Count 242
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7944
GCCGCCCAAATCGAGCACCTCCACAGCCACTCCAGGTTTCCAGCCAAGCCATCCGCCGTCGCAAAATCGAGCCATCTTCTCCCCTCCTCCGCCGCTGCAG
CCGAACCCGATCGACGGAGATGTGGAAACACCACCGGGTCTTAGGATCCGTGGCCGCCCTGCTCCTGCTACTCGCCCTCGTCCTACCGTCTATTCAGACG
CAGAAGCAGAGCGCACGAGAGAAGGCTGCCATGGCGGCGGAACCCGCGCGGCGGTTGGCGGGAGGCATCGTGGACTCGCTGGGGCGGGAGAACGACCCCT
ACATCGTCGACCTCGCCCGCTTCGCCGTCTCCGAGCACAACAAGGAGGGCGTAAGCCCTCGACCCGCCACCCCTTCTTCTTCCCTTTGTTGAATCTGTAT
GCCCGTGTTCGACACCCGGCCGGCCGGCCGGACGATTCGATCGACGCACGCAGGTCCTTCCTTGCGTAGTAGTAGTATTGCATTGGTCTAATCTGAATTC
ACCGCTGCAGAATACCCAGCTGGAGTTGGAGAAAGTGGTGAAGGTCAAGGAGCAAGCTGTTGCCGGCAGGCTCTACTACATCACAATCCAGGTCGATGAA
GGCGGGGCAAAGAAGCTGTATGAAGCCAAGGTGTTGGAGCAGCTGTGGCTGGATGTCAAGAAGCTCGTCGAGTTCAAGCCCGCAGAGGGCGCCTCTCCCA
ACGTTTAAGGCTCGTCAGTCCCAACTGTGCAAGGATCTGGAGATATGGTGTGGATCTAGCTATCATCCATGGAACCTGTCTTTAGCGTGCTCTCTTGTGT
AATAGTATCAAGAACAAGTCTGCTTCTTGCGAGTTGTTTTAACCTGCCCATTATA
page-top