Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7942  (registered. 2003)
Contig Information
Length 295 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit hypothetical protein OsI_00846 [Oryza sativa Indica Group] >gi|125569474|gb|EAZ10989.1| hypothetical protein OsJ_000814 [Oryza sativa (japonica cultivar-group)]
Score 269
Evalue 1.93573e-22
Total Hit Count 454
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7942
GTGCCGCAGGCGTACACGCTGAAGAGGATCAGGGACGGCGAGTTCAGGCCGGCGACGCGGCCGCCGCTGTCCAAGGAGTTCATCGACGAGACGGCGGAGA
GCCTGATGGAGCTCAACCCCAGCAGCGAGTACGACCCCGGGCTGGAGGACACGCTCATCCTCACCATGAAGGGAATCGCCGCGGGCATGCAGAACACGGG
CTGATTCTGAATTTTTCTTCTTGGGTGGACTCTCATGTCCTGGTTCATGGATTTGTGACCCTCTTTTTTTTTTTCTGAAAATAGTAGAAGGATCG
page-top