Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7904  (registered. 2003)
Contig Information
Length 759 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit vegetative cell wall protein gp1 precursor [Zea mays]
Score 353
Evalue 1.04299e-31
Total Hit Count 43
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7904
CCGGCTGGGACGGCGATCACTTCGATCGCTACGATCAGTACAGGTACGCCCTGGCGGTGAACGTGATCGTCTGCGCCTACTCAATCGCGCAATCGCTGGG
TGAGATCCGCCGTCTGGTCGCGGCGAGGTTTATTTACAGGAGCATGTCAAGCTACTACTTCAGCCTGTTCCTTGATCAGGTCCTGGCGTATCTCCTCATG
TCCGCGTCGTCGGCTGCCGCGTCGCGCAACGATCTGTGGGTGTCGAGGTTCAGTCAGGACGCCTTCAACAGGAAGATCACCAGCTCGGTGTGGCTGTCCT
TCCTTGCCTTCATAGCGCTCGCCGCAAGCTCGCTCATCTCCACGGCTAATCTCTTCAGCATGGTCTAATTATGATAGATACGGTTCATCCCTTTCCCTCT
CCCTTTGGGGATGTGGACTGTGGAGTAACTGCCGGCGTTCTTCATGTAAATTTTGCATTTATATTGTCACAAATCATACGATCGACTGATACCGTACGTT
GTTCTCGGTCCTGACCTCTGACTCGTCAGAAAATCCCTTGTAAAGAGGTTCATGTAGTGCTCGAATTAAGTTTTTCAATGTCAAGTAGAATAGCCATAGT
GCTACTCCACTTGTACTACTCGAGTACTGCCTTGTAAACTAATATAAGAGCGTTTAGACTCTTATATTAGTTTACAGAAGGAGTACTTGTCAGTAGTCAC
TGTGTACTCAATGGTGACAGAGGCTTACAACTTGAATGTACACATTTTTCTTTTTCATT
page-top