Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6129  (registered. 2012)
Contig Information
Length 628 bp
Clones alternative view 54 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_r Root 5
Wh_SH - 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 6
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
WH_SP 4
WH_XA Root 2
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|224138380|ref|XP_002326588.1|| predicted protein [Populus trichocarpa]
Score 151
Evalue 5.00E-35
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6129
TTTTTTTTTTGGAACCAACAAACAGGATAGAATTCAGAAGAATTTATCAGGAACAGGGATTCCCCAAAGAAAAAAAAACATCTTAACAACAGAAGACATG
TAGGAGTATTAATCAATCATGGTGTAAACTGAGATTACACTTTCATGTATCACAGGGCTTGTTCAACGTAATTACACCCACGACGGCGATAAGCTTGACA
ACAACTAGTACTTGAAACTTATTTGTGTTTGCTGGCACATATGGCTGCACCACCAGGATAACAATAGCGATTGCGGTTTTGTGGCCTGGGATCAAGCAGA
TGCGGCGGCAGCCTCCTCCAGCAGCTGCTTCACCTTGGTGATGTAGTCAGCCATGGCCTCCTCCTTGGATTTGGCTTCGACGGCCTTCCAAGCATCCCAT
TTGGCCTTGCCAGCCATATCAAAGAGGCCGCCGGGGCGGGCGGTGTTGACGGGGCCGACGGTGGCCTGCTTGTAGAGGCCGTAGAGGCAGAGCTTGCTCT
CGTTGGTGGTGGTGTCGGGCAGCGTCTTGGCCTTCTCCGCGTGCTCCTCAAACTCCTCCTTGAGACCCATGTCGATCGGCTGCTCTCCTCGGCGATAGGA
GCGATCGATGCGAGGCGAGAGGTATCGA
page-top