Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7815  (registered. 2003)
Contig Information
Length 507 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
Homology (BLAST) Top Hit RecName: Full=Defensin Tk-AMP-D6.1
Score 270
Evalue 1.62578e-22
Total Hit Count 210
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7815
CCTCGTGCCGAATTCGGCACGAGGCTCAGTTTGAAGGTCTTAATCTTTCATACAACCCTCTCAGTTTTCCACAAGAAACTAAATGGATCGGTCCATGAAG
GTCTTTGTGGTCGTCTTCCTGCTTCTTGTGGCCACAGAGTTCCAGGGAGCAGTGCAGGTAGCTTTGGCGAGGGAGTGTAGGTCACAGAGCAAACAGTTTG
TGGGGCTGTGCGTGAGCGACACCAACTGCGCAAGTGTTTGCCTGACCGAGCATTTCCCAGGAGGCAAGTGCGACGGCTATCGGCGTTGTTTCTGCACCAA
GGACTGCTAGATGGCCCCGTTTTCTTCTTGCATACATGCTTCCGTGTAATAATAACTGAATAATAATACTAGATCTGAATTTATGCATGTATGATGCATA
TGTGAGTGCTACTCCTAGAAGTACCATGCACATCATATAATCAGAACAAAGTTTCGGCGGGGAACCAGTTCAAGTTGAAAAAAAAAAAACAAAANNCAAA
ANAAAAA
page-top