Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7804  (registered. 2003)
Contig Information
Length 841 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
Homology (BLAST) Top Hit putative chromosome condensation factor [Triticum aestivum]
Score 335
Evalue 2.58424e-55
Total Hit Count 119
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7804
AAATAGTGAAGGCAGCACTCACAGCCTTAGAATTACCAGTCCTCACGGATCGGATCGCCCTCACCGAAGAGCCCACAGCAATAGTGATGAGATGCTGTCT
GCAAGTAGCAGAGGTGATGATAATGTCAGCATAGATGCTAGGTCCCTTCAAAATGGTGACGACAGCTACAAACCTCGAGGAACAATATCAATATCCCAGC
AACCAAGTACAGGCTGAGTGGATCGAGCAGTATGAACCAGGTGTTTACATAACTCTCACGACCCTCCGTGACGGGACTCGGGATCTGAAGAGGGTTCGCT
TCAGCCGAAGGCGCTTTGGGGAGCATCAGGCTGAAAATTGGTGGAACGAAAACCGCGAGAAAGTGTACGAGAAGTACAACGTGAGGAGCTCTGAACGGGT
CTCGTCAGCAGCCTCGACCCGGTCGGCCTATTAGCTTACCTGTGGATGACCTGTTGCACGCCGACACCTGTTTCTTCACACACAAACTGCAAGACCAATC
AACATCAGCAAATTATTAGCAAAACTGTGGTCATACAAACTGGGCTGGAGACCGCCAAATTGCGATGGCCACTGCAATTTTTATCGTCTTTTCATGCTGT
AATACCGATAGGATGATAAGTCAAGTTTTTGGTTGGTGTTGAATCCGCCTGAGGGTGTAGCATGGGCCCTGTCCCAGTGTAATGTACATACATGGACATG
ATCAAACAGGGCATGGTACCTTCACCATGTTATAGATCACACTAGCCATTGTAGCTAGGTGAAGTTTTTTTTTCTCTTCCAGTTTTTTTACCTTTTCCTC
AGTATGATTATTTTTTACAAAAGAACTTGTGTCCTGCAATG
page-top