Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6119  (registered. 2012)
Contig Information
Length 1071 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XA Root 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|24496452|gb|AAN59956.1|| actin [Hordeum vulgare]
Score 559
Evalue 2.00E-157
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6119
GCACGAGGCTTGTGGCTCCGCGTCAGCAGGCCGACAGCAGTGTGTGTGCGTCTGCGAGCGAGATCCAGTCCAGAGCGGCAGCAGTTATAGCCAGCGCCTC
CCCCACCACCACCACCACCTTCCCCCTCCTCCTCCTCCGATCGCATCTCCTCTCCTCCGTCCTCCCCTCCCGTCGCCCGTCTCAGCCTCCTCCGAGCTCG
CTCGCTCGCTCGCTCGCCACGACATTCTGTAGGAAATGGCTGACGGTGAGGACATCCAGCCCCTTGTCTGCGACAATGGAACCGGAATGGTCAAGGCTGG
TTTCGCTGGAGATGATGCGCCAAGGGCTGTTTTCCCTAGCATAGTTGGTCGCCCTCGGCACACTGGTGTCATGGTAGGGATGGGGCAGAAGGATGCCTAT
GTCGGTGATGAGGCGCAGTCCAAGAGAGGTATCCTCACCCTCAAGTACCCCATCGAGCACGGTATCGTGAGCAACTGGGATGACATGGAGAAAATCTGGC
ATCACACCTTCTACAATGAGCTCCGTGTGGCACCTGAGGAGCACCCTGTGTTGCTCACTGAGGCTCCTTTGAACCCAAAAGCCAACAGAGAGAAGATGAC
CCAGATTATGTTTGAGACTTTCAATGTTCCTGCCATGTACGTCGCAATTCAGGCCGTGCTTTCCCTCTATGCAAGTGGTCGTACTACCGGTATCGTTCTC
GACTCTGGTGATGGTGTCAGCCACACTGTGCCCATTTACGAAGGATACGCGCTTCCTCATGCCATTCTTCGTTTGGATCTTGCTGGCCGTGATCTCACGG
ACTCCCTTATGAAGATCCTCACCGAGAGAGGTTACTCCTTCACAACCTCAGCCGAGCGGGAAATTGTAAGGGACATCAAGGAGAAACTTGCGTATGTTGC
CCTTGATTATGAACAGGAGCTGGAGACTGCCAAGAACAGCTCCTCAGTTGAGAAGAGCTACGAGCTTCCTGATGGTCAGGTGATCACGATTGGCGCAGAG
AGGTTCAGGTGCCCTGAGGTCCTCTTCCAGCCATCCATGATCGGCATGGAGTCTTCTGGAATCCATGAGAC
page-top