Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6117  (registered. 2012)
Contig Information
Length 1388 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 4
Wh_V483 Shoot grown under cold condition for 3days 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|212721534|ref|NP_001132324.1|| hypothetical protein LOC100193766 [Zea mays]
Score 486
Evalue 3.00E-135
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6117
TGGTCCAGTGTCTACTATCACCTGACCTAGGAGGTTAATTAGTCCAAGAATTCAAGGCAAGACAACTCAGGCAGGCATTGTTTTCTTTTACAGCAAGGCA
CCTCAGTCAGACATTGTTGATGCCGAAAGCTAATTTGGACTCTGAAACAGCCGGAAGAAAACAATTGAACCGTAAGAAAATATAAGTATGGCTAGGAAGC
ATCTGGGGGCAGCATTACAAAGACAAAGTCCAAGCCAATTGTACAAATCCATCGGATCGACAACGCGTGTGAGTTACCTACTTCTACTTAATTACAAGAT
CCTTTGATCCTCGGGCGTGACAGATTGCTAGTGCATCGCGCTCAGGATCTTGTTCGCCGCACTGGTGTGATCTGTGTTGAGAGTTCACTTGATATCGACG
AACAGGTATGCAGGTAGTTTGCCTCAGCTTCTGCTCGCTCCACCTCGGTCTGTGTGGATTGCATGCAGATGTGGATGTGGATCCAGGGTTGACAAAACCT
GGGGCATTGACATACCACCAGACACAACGATCTCAATGCCTTCACGCACAGAAAGATTAGGCCTTATCACATCCTTTGAGTTCACCATGAAGATATCACC
AATGTAGAGATGGTTGGTCGGCACATAGACACAGTAGAGGTCCTCTTGACCAGAATAGCTCTGGAGCGAGACTGATGAGGTAATGAATCCAAATGCATAT
TCCCCAATACGAGGATGTCGTATGATGACTGCCTCCTTGAATGCCTGTTTGTTTTGATCTGGCGATATAGCAGCACTAATTTGCTTGGATGCATTGTAGA
TATGGCGCACAAGTGGCATGCGCTTGATGATCCATTCACCAATGCCAAGAACAGATGCTCCAACCCAAGATGACATGAAGACTCCAACGAAAAATATGAA
AGTAACAGAAGTGATGAAGCCAAGACCAAAAATGTTGATTCCCAATTGTGCATAGATTGGAGAGAAGAATCCATCAACAAAATGAATGAACCACCAGGTG
AAGTAGAATGTTATTGCTATGGGGAAGAGAATCACACATCCAGTCATGAATTTCTTTGAGGCCCAGCTGCGAACCACCTTATGGAAAGCCTCGCGGCCGG
TGGAGGAGAGCGCGGCGGAGGCGGAGGGGGAGGCGGCGGTCCTGTCCAGGTCGTCGTCGTCTTCCCCGGTGCGGGGGACCGAGCCGCCGCCGCCGCCGCC
GGAGACGGGGATGAGGAGCTCGCGGTCGCGGTCGCGGCCGCCCATCGGGCTGAGGCTCCGCGGGGCCTTGTCGTCGCCCATCATCGGGGGCTCGGGCTCC
GCGCGCGGTGGCCGGCGCGGGTCGTCGCGACCGATCGCCGTGGAATGGGGTGCGTGCCGGGTGCGGCAGGGAGGGGAGAGGAGACGCT
page-top