Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7684  (registered. 2003)
Contig Information
Length 784 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_VABA Shoot with ABA treatment 1
Homology (BLAST) Top Hit hypothetical protein OsJ_000033 [Oryza sativa (japonica cultivar-group)]
Score 1130
Evalue 8.94109e-122
Total Hit Count 74
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7684
AATCCCCACCGCCCAACCCCAACCCCCACCCTCCCCGGCGCGTGCGATGCTTCGGCGCCGGCGGCGGCCACGGGTGGTGCAGTGATGGTGGGCTTCTTCC
GCAGCGGCAACCTTGCCTCCAGGGTGTTCGACCGCCAGTTCCTCTCTCCGCGCCCCGGCGCAACCGTTAATACTGTCAGACAATTCTATGAGAATTTGGT
TCCAAGTTACACTATATACGACATAGATTGCCCAGATTATTCGTTTCGCAAGTTCACTGATGATGGCAAGTATCTTGTGGCCTTTAGTCGAAACCACCAA
GATTTGATTGTGTACCGTCCCATCTGGTTAACGTTTTCATGCCATGAAGAATGTGATTCTCATGATCTTCCGGCCAATGCAGAGAGATTTGACAGTTTCT
TTAAGCAGCTCTACTCAATCTCACTTGCATCCAGCAATGAGTACATTTGTAAGGACTTTTTCCTTTACATGGAGTGCCATCAATATGGCTTATTTGCAAC
GTCAACTGCACAAAGTAATGACTCAAGTGCCACTGACGGTGCAATTCACGGGGTACCATCAATTGAGAAAATAACTTTCTATCTTGTGAGGCTAGAAGAT
GGTGCAATACTAGACGAGAAAGCTTTCTGCAATGATTTTATCAATTTGGCTCATAGTATTGGTGCTTACTTGTATGAGGATCTGGTTTGCATTGTCTCTC
TACGATATCAAACAATACATGTCCTACAAATCCGAGATTCAGGCAGCCTTGTTGAGGTACGGAGAATTGGTGCATTTTGCCGGG
page-top