Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7547  (registered. 2003)
Contig Information
Length 1267 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Homology (BLAST) Top Hit RecName: Full=Probable protein arginine N-methyltransferase 7
Score 1065
Evalue 1.91739e-159
Total Hit Count 140
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7547
AGCATTGTGTTTGGTTTACACAAGGAAGGGGTGCTCCTGTTATGAAAGATCAAACTCTTTCTCTAAGGGCTAGTCATAACCTCACTAGCATCTCTTATCA
GCTGCTAAACCCCAATGATGAAGCATGCAATGGAAACTTGAAAGCTGACCATCTAACATTGTTGCCAGAAAGGATAGCACTTTATGGTGATATATGTTGG
AGATCAGCTTTGATAACAGCAATTAAAAGTGCTCTGAGTGACAGATCTCCGCAAACCTGTATTGTGGCTGATGACAGTATATTCTTAGCTCTCTTAGTTT
CTTCTCTCTCACCATCTTCAAAAGTCATTGCCATGTTTCCTGGTCTACGGGACAAGGGTGCAACATATCTCCAAGCTGTTGCAAAGGCAAACAATTTCTC
CATGGATCAAAATTCAAGTGATTGGTAAAAGAGCGGCATCTCTTTCAACGGATGATTTGGAACATAAAAAGATTAACTTATTAGTGGGCGAACCATTTTA
TTGTGGCAGTGAAGGGATGCTTCCATGGCAAAACCTGCGTTTCTGGAATGCAAGAACTCTGTTTCATTCAATGTTATCCGAGGATGCACTCATAATGCCT
TGCAAAGGAGTATTAAAATTATGCGCCATGTCTCTTCCTGACTTGTGGAAGAGCCGTCGCAGCCTTAAAGATGTCGAGGGTTTTGACCACTCGGTTGTTA
ACGAGACTTTAGGAGCCTGCGGTGATCTGCCCGGAGAGCAGCAAGGTCCTTGTCTTCCCTATTATGTATGGCAATGTGGTTATACGAAGAAATTAAGCAA
AGTGTACTCTCTCATGGACTTCAACTTTTCTGAGCCTATTCACTCCTGCTTTGGGAAAACAAAGATCGAGTTTGCCGATGCGGGCATGTGCCACGGCTTC
GCGGTTTGGATCGACTGGGTGCTCGACGAGAAGAACTCCATTGTGATAAGCACGGGACCAGATAGCAGATACTGGAAGCAAGGCGTGCAGCTCCTGAGTA
AGCCTGTGGAAGTGAACCCAGCCGAGTCGGCTGCGCTCGTGGAGGCCTCCTTCGATCCTGCCTCTGGCGACATCACATTCAATTCCTCCTTCTCTTGATG
TAAGCTGTAACATTGGACCTGTCGCGCGCACGCGACGAAGACAAGATATTGCCGCTCGTGACAACCTTTGTCGATAGTTCTTCCTGTTTATTTGTTTGTT
TGTTTTGCGGGGAGACTCTGCCTGTAGTTCAGGGTCTGATTGAGCTAAAAAACAGTGCTGAGGCCCA
page-top