Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7464  (registered. 2003)
Contig Information
Length 793 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit supt5h protein, putative [Toxoplasma gondii ME49]
Score 84
Evalue 1.78651
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7464
TCTTGATTCAGTTTTCGCCTCACTGGCACATCCATTCTCTCCAGGCTCTAGCACCGTCTTGCCTCCGGCAGTTGGAGACGGAGCATCTGGTCATGGAAAG
CCGCATCAGGACGTTCGGTGCGGTGGTCATGGCGCACCATGCTGGGTCTACTTCACCATCGTCGTGCTCCGCAGCCGCCTACAGCCGACGCACCGATGAG
GTCCGACATGGAGCACAGTAGCAAGCACCAGTTTGAGGCGAGGTATATCGCATTGGTCTCCTGCTGCTCACAGGCGAGGCCTCGGACGAGCGGCCAAATC
CACGTGAGGTGGATGTTGCAGGTTCGTCCCCAATTATAAAATTTGGAGCCTCCCGCTGAAGGTCCAAGGAGGTGGAAGCATGAACAATGCCCTCATCAAA
TCAATTTAACTGGATTCGAATCGAAGGATGACTTTCGAGAAAAGTTGTTTTACAAATTGAGGAGGGGTAGCAGATGGATGGCATTGCCATGCAGAACTGA
AAACACTGTTGTATGACTACAGACTCTTCACTGGAATAAAAATAGTTATGTGGTGTTTGGTCGGACGTGCGCATTTGCAGCACCATGGGGTGGAGCACCA
TGTATAATTTATGGCTAAATCACATCGGCAGGGAAGCACTATCTAGGACCGTTTAGACACTACCTAGAAGAGTGTTATGTCTACAAAGGTACAGAGTTCG
GACACTAGCTAGAAGAGTGTTCTGTCTACAAAGGTATAGAAAGACAAATAGTTTCATTTCTCATGTTGATAGTCAGTGTAGAAAGACAAGAGT
page-top