Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7413  (registered. 2003)
Contig Information
Length 788 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit hypothetical protein OsI_11040 [Oryza sativa Indica Group]
Score 826
Evalue 1.60531e-86
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7413
GGCTCCGCCAAGGCCATCATCCACCGGGACGTCAAGTCGGCCAACATCCTCCTCGACGAGAGCTTCATGGCCAAGGTGGCCGACTTCGGGCTGTCCAAGA
ACGGGCCGGAGCTGGACAAGACGCACGTGAGCACCAAGGTGAAGGGCAGCTTCGGGTACCTGGACCCGGAGTACTTCCGGCGGCAGATGCTGACGGAGAA
GTCGGACGTTTACTCCTTCGGCGTGGTCCTGCTGGAGGCGCTCTGCGCCCGCACCGTCATCGACCCGACGCTGCCGCGGGAGATGGTGAGCCTGGCGGAG
TGGGCGACGCCGTGTCTCAGAAACGGCCAGCTCGACCAGATCGTCGACCAGAGGATCGCCGGGACGATACGGCCGGGGTCGCTCAAGAAGCTCGCGGACA
CGGCCGAGAAGTGCCTCGCCGAGTACGGGGTGGAGCGGCCCACCATGGGGGACGTGCTCTGGTGCCTCGAGTTCGCGCTGCAGCTGCAGGTGGGGTCGTC
AGACAGCTCGGACGTCGACACCATGTTGCCGCCGGCGCCGCCCGTGCCCGTGAAAACGCCTGAGGTTCAGCGTCGCCTGTCCGCCGCTACCGTGGCGACT
GACGCTGCTGCCATGACCACCAACTTGGGTGACCTAGACGGAATGTCCCTGAGCGGAGTATTCTCGAACATGATCAAGAGCGACGAGGTCAGGTGAAGCC
AAAAGGTGCTTCGTCCACGTTGTACAAACTGAAGCACGTGTATATTCGGTCAATTTAGTGTTTATAGCATGTAGTACATGACAAACGA
page-top