Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7325  (registered. 2003)
Contig Information
Length 886 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Homology (BLAST) Top Hit hypothetical protein OsJ_005806 [Oryza sativa (japonica cultivar-group)]
Score 303
Evalue 7.26678e-37
Total Hit Count 247
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7325
TTTCATGAGTTGTCGTCCTTAAATGGGTTATCCAAGGTTTCCAGCACAGTGAAAGAACTCTACTTTTCGAAGAATGAGGTTCCAAAGATGGAAGAACTTG
AACATTTCCATGCATTAGAATTGCTTGAACTTGGTAGCAACAGATTAAGGGTGATGGAAAATCTGGAAACTTTGACAAATCTACAGGAGTTATGGCTCGG
AAGAAACCGGATCCGGACTATCAACTTATGTGGGTTGAAATCAATCAAAAAAATAAGTCTGCAAAGCAACAGGCTAACTTCAATGAATGGCTTACAAGTA
CCGTGTCGTACCTTCACCAGCTCCCTAACTTTTTGCTGAAGTTAGAGGACTTGTGGTTGAATGACAACCAAATACCATCACTGTCTGGGATAGAATCTGC
TTTGTCTGGTTCACGAGAGAAACTGACCACCATATATCTTGAGAGAAATCCTTGTGCAAAAACTCCCAACTATTCATCCACATTGAAGGAAATGTTTCCA
AATCTTGAGCAAATTGATTCAGATATGCTAGCGTGAAACAGGTTGACTCACTTTCTCAGATTGTTGAAGTTAGTCGAAATATGTGTTGTGTTTCTACAGG
AAGAAAGCAGTCATCCAGTTCAGAACAGACAACATAAGCTCCCGGTCAAGTAGCGCTGCAGTTTGTACTGGTGATCTGAATGGATTATTGCCAACTTTAT
TTGAAAGGCCCGTCCTGAAGTTGGGTCATTTCCTGCCGAGATCTATAAAAACTGAACTTATGTGATAAAGCCATCCTATGGTCCATGACTCCATGCTCGT
GCCACGTTGCAAGGGATGATGTATTTGTTTTCCCTTTTCCCTTGAGTGATTTTTCAGTTATTACTTGGTCTAAGTTTATGAAGCTG
page-top