Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7321  (registered. 2003)
Contig Information
Length 865 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Homology (BLAST) Top Hit 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imi dazole-4-carboxamide isomerase [Zea mays]
Score 976
Evalue 7.61255e-104
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7321
GGACTTGTTGGTGGACATGTAATAATGCTTGGCGGAGACCCTGCAAGCCGTTCTGCTGCCCTGGAAGCACTGCATGCATATCCTGGTGGTTTGCAAGTTG
GAGGTGGAATAAATTTGGAGAATGCAATGTCATACCTTAATGAAGGAGCAAGTCACGTGATTGTAACTTCTTATGTGTTTAGTGATGGCAAAATGAACAT
TGAAAGGCTAACGCAACTTGTCGAGCTTGTTGGGAAACAAAGGCTTATTTTGGACCTGAGTTGTCGGAAAAAGGATGGCAGATATGCCATTGTGACTGAC
AGATGGCAGAAGTTCAGTGATGTCTTTGTGGATGGGCCAACATTAGAACGTCTTGCTGCATATGCAGATGAGTTTTTGGTTCATGGAGTTGATGTGGAGG
GCAAAAGGTTAGGAATTGACGAGGAACTTGTGGAACTATTGGGAAGCCATTCACCTATCCCGACAACATATGCTGGGGGTGTGTCAACGATGGACGACCT
GGAGAGGATCAAGAAAGCAGGGAAAGGTCGAGTCGATGTCACTGTCGGGAGTGCCCTAGACATATTCGGGGGAGATTTGCCCTACGATACTGTTGTCCGT
TGGCACAAGGAGCAAAACCTGGTTAGCCAACGGTGAAGAAATCAGATGATCTTTTTATAGAGCAAATGATCGAAGTTCAGCTCATGTGTGATCCCCACCT
GACCGTGGTCAGGTCAGGTTATAGAGCTTTATTGTTTGCTGGACATTGTAGTGTGAACCGCGTAGTGTGAATGTGTCTTGTGTGACATGTCAAAGCTGAA
GCGGAGGTGTCAACTCAGTGTCGTAGAGGACCACCCGGTATTCAGATACTGTTCTTCACATTCTG
page-top