Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6075  (registered. 2012)
Contig Information
Length 1304 bp
Clones alternative view 115 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 8
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 9
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 3
Wh_r Root 1
Wh_yd Spikelet at late flowering 5
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 9
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 6
WH_XN Leaves, plant was grown at constant 23 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_SP 2
WH_XA Root 8
WH_XB Root 7
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|232033|sp|P29546.2|EF1B_WHEAT|EF1B_WHEAT RecName: Full=Elongation factor 1-beta; Short=EF-1-beta; AltName:
Score 409
Evalue 4.00E-112
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6075
GAGAGCTTCTTATTGCTTGGTGGTAAGATCGAGTTCCGAGNNNNAGCTCAGATATGGAAACAACTGTAAACAAGAACATCTGGATCATCCTATCACAGTT
ATCAAAGACTGATTTTACTCCACATGATAGATGTTTCGCCATTACAAACCGCTCAGCAATTCAACTATTTAAAGGTAGCAGGCATTCAAGACCAGGGCAT
CACTCAAAAACAAAACCAGTAGCATTTCTGTAAGAGGGGTAACTAAATGGGACGACATAATGTTTTCCAGATCAACCAATCCCAGTACCAAGAATCCAGC
AGCAACAGGTGGGCGAACAAAGATTCTAGATCTTGTTGAAGGCAACGATGTCACACGACTGGACATACTCGTTGATGGGCGCCTCACAGAGCACTTCCTC
AATAAGGGTGTCGACAGACACAAGGTCGTCGATGATCGTCAGCATGATCTGGAGCTTCTTGATGCCATAACCCACAGGCATAAGCTTAGATGCACCCCAG
GTGAGACCCTCCATTTGAACACTGCGGACAGCCTCCTCCAACTTCTTCATGTCAGTCTCATCGTCCCATGGCTTGATGTCCATGAGGACGGAGGATTTGC
CACTTTCTTTCTTCTTTGCAGGCTTGGCAGCCTCACGCTCAGCTGCTGCTTTCTTGTCCTCCTCGGTCTCATCGCCGAACAGATCCATGTCATCGTCATC
ATCTTCATCCTTGGAAGCAGCAGGAGCAGCTGCAGCAGGAGCCGAGGATGCACTCACCCCAGAGGCCTGGCCAGGGAACCTTGAAGAAACGGCCGCGGCG
ACGGCGTCGTACCAGCGGGCAGCGTTCAGGAACTCGGCGCTGGGCTTCACGGGCACCGCCGCGAACACCTTGACGTCGTCCTTGGTGATCCCATCGCCGG
AGATGTAGGTCTTGCCGGCGAGGTGCGCCTCGAGGGCCTTGAGCCCGTCGGCGGTGTGGAGGTCGGAGAACGTGACGGCCATCGGATCCGGCGAGCTCGG
GGGCTTGTCGAATTCGCTGGGCGGCGGCGGCGGCGCTGGAGGCTAAAATCCCACCTCGTGCCGAATTCGGCACGAGGCTCCATTTCAGTTTTCATTGAGG
CTGTGTGCTGGCGGGTTGAACAAGAACTGTCATTGGTTTCGGGGTGGTTTTATTTTGGGGCAGCTGTGGAGTTTGATTTGTTATTTACGGGAACTGTATA
ATTGGGTGGAACTCTGCCGCCTCCTATCTCATGTGTCAGTATCATTCGCTGTGTATACAAGGATTTGATCATGAACGGGTTCAGTGATATGGGTCTTTGT
CTCT
page-top