Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6059  (registered. 2012)
Contig Information
Length 785 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222617519|gb|EEE53651.1|| hypothetical protein OsJ_36952 [Oryza sativa Japonica Group]
Score 251
Evalue 5.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6059
GCACGAGGCGGGTCGCAGTCGTACAAAACCTTCTTTGCTCTCGTTCNTGGTCCAAGCCTAACCCTAGCCGTCACCCCCNNNNNNNCTCGCACGCGAACCC
TCCCGGCAGATATCAGCCGGGCGCTAGGGGGCGGAGGGAGACGTCCGTCGCGAGCTTCCTGCGCGCTCTTCTCTCCCCTGTGACCCGGCTGCCGACGGCC
GGCGCGCGCGCGGAAGGTTCTCCTCCCCGCGGACCCCCCCCCATAAAAGGTGTTGAGATTTATCAGGAAAATACTTATACAATATGGCTGGGGGTAGCAC
AGATGCAGCAACCAAGGAGATGGAGGCATTGCATGTTGGGCAAACCAAGGAAACAGATGAGATTCTGAAAAAGGCGTCAGATAGCAATGGCGGGGCTCCC
GAAGCTCAGTCCCCACCACCACCAGCAGATGATGATGACGCACAAGTGGATGGTCCATCTGAAGGTGGAGCAGGAGCTTCAGCGGCTGCGAAGAAGAAAA
AGAAGAAAAGCAAGGCCAAAAAGAAGAAGGACCCCCTTCAGCAGACAGATCCTCCATCAATCCCTGTGGATGAGCTTTTCCCTTCAGGAGATTTTCCTGA
GGGAGAAATCCAGGAATACAAGGATGATAATTTATGGAGAACAACTAGTGAAGAAAAGAGGGAACAGGAACGACTACAAAAACCAATGTACAATTCTGTT
CGCCGAGCTGCNNNAGTCCATCGACAGGTACGAAAGTACATGAGGAGCATTATAAAGCCTGGAATGCTAATGATGGAACTATGCG
page-top