Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7123  (registered. 2003)
Contig Information
Length 645 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit predicted protein [Physcomitrella patens subsp. patens] >gi|162674186|gb|EDQ60698.1| predicted protein [Physcomitrella patens subsp. patens]
Score 98
Evalue 0.0277686
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7123
CTGCATTCCCCCTTTTGCCCTCGCTAGATCCGCCCACTCCCGATAGCCTTTGCCGCTCACCGCCGTCGATCCCGCGCTCTCCGACGACCCCGAGCCCCGG
CGAGATGTCACGGAGCTTCGTCGCCCTCCGCTGCGTCGCCTGAGCCGAGCCACTAGAGACGACGGGCTCGGCATCGAGCGGATCGAGCTTGTCTCCGTCT
TCTGCGTCGCCGGTGACCACCGCCGTCTTCGTCATCCCCTGCTGCTACAAAGCTGTCGAGGGCCTTTCTTGGCCGCTCGACCCGAGACCGATGCTGCCCC
TGTGATCGACTACATCGACGACGACCCTCCTTGCCAGAGCAACCAGATGGTGGAGCCCAGGATCCAGACGACACCACCGACGACTACTACTACCCCGAGG
GTGCCTACTACTACGTGAAGGCCACCGACGACCAGGAGTAGTTAGGAGGCTACCAGGTAGGAGGCCTTGCCCTTTCGATCGTTGCTGCTTTTGTGCTAGC
CTTCTTAAGGCAAACTTGTCTAACTCATGTCTGTACTCAGATATTGTTGCTTCCGCTGACTTTTGTGTTTTCGAGCTTATGTATTGGAGCCCTCGAGGCC
CCTGGCTTGTAATATAAAGCTTGTATTATTTTGATTTATGTCTAA
page-top