Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7111  (registered. 2003)
Contig Information
Length 472 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein LOC100192571 [Zea mays] >gi|194691014|gb|ACF79591.1| unknown [Zea mays] >gi|195621662|gb|ACG32661.1| hypothetical protein [Zea mays] >gi|195638428|gb|ACG38682.1| hypothetical protein [Zea mays]
Score 151
Evalue 9.28838e-09
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7111
GGACAGATGAGAGCAATGGAAGAGAATGTGGAGAAGACAGCAGAGGTAGCAATCGAGACTATCGAGAAAGCGGCGGATGTGGTTGACAAACTTGCAGATG
AAGTCATAGCATTTCCTGGTAATGAAAACCTTAAGAAGGCAGCCTTCAGGATCAAAGCCATCGCGGAAGAGATAGAGAAGGATGCAGAGGAAGCCGAGGC
CCTAATCCACAAGGTTGAAGAGATAGAAAAGGAGGTGGATGCTGCAGTGGATACTTTCATGGGGAAGGGCATGAAGAAGGGATCGAGATGAATGGGATAA
GAAATAAAAGTAACAGTTACTAATAGTAGAAGTTAACAAATAAATATAGGATCATCTTCTCATCGGATTGTAAGCCAGATCGATGCATGCAGGCTTGCAC
ACCCCGGTTTTGAGTCCATTGTTTACCTGTGTCCACCTTCTATGTTAGAAAATACGGGGTACAAAAAAAAAA
page-top