Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7095  (registered. 2003)
Contig Information
Length 1229 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit Os06g0473200 [Oryza sativa (japonica cultivar-group)] >gi|113595668|dbj|BAF19542.1| Os06g0473200 [Oryza sativa (japonica cultivar-group)]
Score 759
Evalue 1.92719e-78
Total Hit Count 38
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7095
GCGCGCTGGACTCAAAGAAACGTCACTGAAGGGCCTGCCAAAGGAGAAGAGAAAATCTCAATCATTAGCCAGAAACGATGACCAGCCTGGTTACTAGTCC
TCGCGAAGGCGGTCACGACCTCGTCGCTGCAGAGAGGGCATGCCATCAAAGGGAGCAGCCAATCGGCTGGGACAGGAAGGGAAGATGAAGACGATGCGGA
CATGGCAGCGCGGACGAGATTGAACAATGGCGATGGCCAAGCAGGGGCGAGCTCGGGAGAGTAAATGGAGATGGGTGGTGTGCTGGCTAGAGTGAATGAG
CTGGTTGGGCTGGTGAGCATTTATGGAGCTGGCGCTCCGACGCCGTTTGTGCTGTGAATCTTGCGTCATACGGCTCATGCAGGCTCAGATGTGGTGCCGA
GCCGTCGCACCTCCAACGGGGCCGCGACGTGCCGTCTCCATAAATGCACCTCTGACACGCGAGCCAGAAAAGAGATATACGGCCTGAAAATACATGAAGA
CACACAGATCTTGGCGCAGACCATCGGTGTGGATTTCGGGAGCAGCTGAGCCCGAGCTCAGAATCGAATTTTCGCTGATGAAAGGTCTACATGTGAGCAG
CTTTTGTCACACCCATTCATCAAGAGGTATGAGGAAGCCGGTGTCGACTTGGCGGCATACGTCGGGGGTGTTGTGAATCCAACAGAAAGGTTGAAGCAAA
TAGCAGAGATGCTTGTTGTTCATTATTACCTTCTGTTCAATGGCTCTGATGGATCCTGGCATCATATGAAGACACCGTACATGGAAGAATCATCTTTCCG
CTTCTCAGGGAATGTGTATGTCGGGCAAAGTGCCATATTTGATACTTTGTCAACCATAAGAAACAAGTTTAAAGGTGATCAGCCTAGTGGGGGGATTTTT
CATGTTGTTGAGAAGATACATTGTGGTGCAGATGGGGAAAGAGAGATCACCGTTCGTGTGTCTGGATCATTCATTGTGGGCAACCAATTTCTAATACTTG
GTGAAGGGCTGCAAGCTGAAGGGATGCCCAGCCCAGACGAGCTCGCAATTGACATTCCAAGCAATCGGGCAGGCCAGTTCCGGGAGCAGTTCATCATGCA
GCCAGGGATTTCCATGGAATGCTACTACATACCAAGACAAGATCTCTCCATCAGCTAGTCCCGACAAGATTTGTAATTTGTAAGACTTCTTGGGCTAGTT
TAGCTTAAACTTATCTGCTCACAAAAACA
page-top