Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6996  (registered. 2003)
Contig Information
Length 817 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit hypothetical protein OsJ_029218 [Oryza sativa (japonica cultivar-group)]
Score 154
Evalue 1.42003e-08
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6996
GCTTTGCGCAAAGTTCATTAGTTGTTTCTTTGTCTTCATAAGCTTGTTTTCTTACACTCTCCAACTCCCGGAGCATATGCTGGAATTTATTGTCAGCCTC
ATCAAATTCGTGAACAGTTTCCTGGGTGAGATAAGGTAAAACTTCATGTCATGTCAAGGTTTTCTTGAATGTTTAATATCTTCATCCTATTTCGTGTATT
TATCAAGCAAATTCTTCAGCATGGACCACATTTGAAGTGCATATGCATTTCTGATTGCTTCATCAGTGACCATACAAAGTTTAAGTGTGGATGCATATTG
CTTACTGAAGATGTGGAGAATATAAATGAAGCAGCTTCTTTGTTCCTTGAAGTGTAACTGCTAAACTTTAAGTATGCCAAAATAAATATCATTTATATAA
TTGTGTTTACCTTTTCATTACCGTCGGATCGTCTGAGATTTGGTTTGTGCAGCCATGTATTTGAAACACACCACATCTCTGACAAGCTAGTTGATCTATC
CACTGAAAACTGTTGAGCACCAGGCTTTTGTGTACCTTGCGGCATTGCCCCATGGCTAAGGGGAACAGCCTTCCTAGTGTAGAGAGAATGCAGACAAGGA
GGGTAACATGTCAAATGCAGGCTGGAGTTCTGCAACGTAAGTGAAGAGTATCCGGCGCTCGACCAACCGTACTTACGTCAGCTCCTGCTCTTGCACCTGG
CTAGCAGGGATCCTGGCACCCACTGTGAACAACATTGGAGTACTAGCAGGTAATGAAACTACAAAGCTGCATAGAAGAACTTCTTTTTGAAATGGGGAAT
ATACTAATATCATGAAG
page-top