Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6978  (registered. 2003)
Contig Information
Length 810 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit hypothetical protein OsI_15463 [Oryza sativa Indica Group]
Score 609
Evalue 2.43047e-61
Total Hit Count 394
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6978
CAGAAAGATCCTTGATGGGGTTGAAGATGTGAAGATGAGGGCTGCAAAAGCTGGTGTCAAAGGAGTCGAACTACGGTTCCTCAACTCCCTTGGTGCCGAA
ATCTCTTTTCTGAGAGCAGAAAATAAAAGCCTTCACGACCAGCGGAAGGATACAGCTGAGGCTGTTCAAGCTGCTGGTGAATTGCTGGTACGACTGAAGG
AGGCCGAGGAAGCGACAACAGTTGCCCAGAACCGAGCCTTGTTGGCAGAGCAGGAGACGGAGAAAGCATATCAGGAGATAGACAACTTAAAGAAGAACTA
CGACCATGAAATCGTCGCGCTAAATCAACGCCTGACAGAGTACTCCAAGCACAACGATGCTACACCTCTGCCTGCCGCATCCAGCAATCTCGACTCTGCA
CCCAGATATGACTCGGTTGGTGGTAGCCCTGGCGATGATCAGCAATGGAGGGGGGAGTTGGACGCCATACACCAGCAGGGATCACTGGAGGTCACCAAGA
GCACTGACCTCAACTCGTGGTTCTCCGGATACGACAGATGCAACATCTGATGACGCCGTCACCGTTTATCTCTCCCTTGGGAGGAAAGGGTTAGTGGCAG
TAGTATGTTGTACACCTTGTAAGCATCAGATCAGAGGGCCAAGGACGCGTTTCTCTTCACCGACCGACCGTCCGTGTGTGGCGTTGTCATTGCAGATTCT
TCAAGTGTACTATTATTCTCCCTTGTATATTACGATGGACAGCGGCGCTCTACATTACAAGAGCCAGGGCGATGCCCTTCTCAATCTTTTACCAATGAGC
AAAAAAAAAA
page-top