Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig603  (registered. 2012)
Contig Information
Length 600 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 5
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|122044864|sp|P05621.2|H2B2_WHEAT|H2B2_WHEAT RecName: Full=Histone H2B.2
Score 248
Evalue 2.00E-64
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig603
AACAGCAACATCACTATTTCTTCAGAAACACAAGCAGCACAATTCTTACAGAGATTGTAACATCGTACTACTGCCGACTACGTACACGACGCCTGCCGCC
ATCAACTCATGAAACAACAACGAAGCCAGCCTAGGATGAGGTGAACTTGGTGACGGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCGCCGGGG
AGGACGAGGCGGACGGAGGTCTGGATCTCCCGGGACGTGATGGTGGGCTTCTTGTTGTAGCGGGCCAGCTTGGCGGACTCGCCGGCGAGCTTCTCGAAGA
TGTCGTTGATGAAGGAGTTCATGATGGACATGGCCTTGGAGGAGATGCCGATGTCCGGGTGCACCTGTTTGAGCACCTTGAAGATGTAGATCTTGTACGT
CTCCACGCCCTTCTTGGCCTTGCTGCCCTTCTTCCTGCCCCTCGTCTTCCCCTCGCCGCCGGCCTCCTTGGTCGCCGGCGCCCGCTTCTCCGCCTTGGGC
TTCTTCCCCGCGGTGGTCTTCTCGGCCGTGGCCACCGGCTTCTTCTCCGCTGCCTTGGGTGCCATGGGTGCTGGTGGTGGTGGTGGTTCGAGCGTGGGGC
page-top