Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6870  (registered. 2003)
Contig Information
Length 244 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit phospholipase C, phosphocholine-specific [Burkholderia cenocepacia MC0-3] >gi|169819286|gb|ACA93868.1| phospholipase C, phosphocholine-specific [Burkholderia cenocepacia MC0-3]
Score 75
Evalue 5.99562
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6870
CACCATGCCCAGCCTGCAGCTGAAGGACTGATCGACGGTTTACCAGCACCAAAGCGGTTAAATAAGGCTAGTAAGTTCGTGTCTCCGTATGCAGACACCA
GTACATTGTATGGAGTGTTCAAAAAAGACCATAGATTCTTTTCTTTTTGTGGGATTAAATAAGGCTGATGATTCTGTGTGTATACAAATTCCTATAATCC
CAATGGTAACGTGCGGGTATCCGCTAGCAAAGGTAAAAAAAAAA
page-top