Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6028  (registered. 2012)
Contig Information
Length 798 bp
Clones alternative view 139 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 4
Wh_EM Dormant seed with water absorption 9
Wh_EMI Dormant seed with water absorption after breaking 13
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_VSCB Liquid cultured tissue 5
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 15
WH_XA Root 9
WH_XB Root 15
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242058553|ref|XP_002458422.1|| hypothetical protein SORBIDRAFT_03g033230 [Sorghum bicolor]
Score 259
Evalue 3.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6028
GATCCACTTCAACATAGAAACATTCAAGGGGTAAATAAACCACACAATGCATTTTGACTGCTTAATGGCCGAAACCAAGAACAACGACAGCAGGTGTATA
TGAGATAGTCTGACCAAGTTCCTCAAAATCTTAGCATAAGATACTACAAAATGCCCTCTTAACATAACGGGAGATTGACACAAATGGCAAAGTCTTTTCT
AGTCATAATTAAGCACTCAGCAACATTGCCACAGGGATACCGTCCTAAACCAAGCAAAGGCTGATAGTGAATAGATGAAGACAGAAATGTTCTTATTTCT
TCTTGGCATCTCCGGCCTTGGTCTTCTTCACACCACGGATCTTCTTTGTCCTGTTCTTCCTTTCCTTGATCTGCTTGCGTGACTTCTCTACCTTGGTAGC
AAGGCCGTTCCTGATGAGGCGGTACTTGGGCTCGAACTTCTTGGCAGATTCGAGGTTGTCGTAGATGAGACCGAATCCGGAGGACTTGCCGCCTCCGAAG
TGGGTGCGGAACTTGAACACGAAGATGCAGTTGGGGTCCTTCACCTCGTACACCTTGGCCAGCCTCTCCTTCAGCTCCGCCTTGGAGACGTTGGCGCGGC
CGGGGTGGATGACCTCGAGCACGAACTGCTTGCGGGCGAGCAGGCGGTTGGTCATGAACTTGCGGGTGCGGAGGGTGACCGCCGTCGTGGCCTTGGCGTC
TGCCATGGCTTATTCGACCTCGCTTCGCGGTGGGCTGCCTGCGGAGGAGGTGGCGGCTGCGGCGGCGCGAGAGGAGAACTAGTCACGAGGCCTCGTGC
page-top