Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6780  (registered. 2003)
Contig Information
Length 856 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Homology (BLAST) Top Hit Chitin-inducible gibberellin-responsive protein 2, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 544
Evalue 9.35786e-54
Total Hit Count 85
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6780
TTTCCTTCCCCTCCTCCCCCTCCTCTCCCCGCCTGCTCCGTCCATCCCCCCTATCTCCTCCCCGCCTCCTTCCAGCTCTTGTACTACTCGGAGCGCCTCC
ACCCCCGACCCCGACCGCCCAACCACCTGCCTCTTGCTTCTCCCGCTGTCCGGGCCAAGAATCCGAGATCCTCCCCGGCGCCGCCGCCTGTTTCTTCATG
GCCGCATAGATGGCAGGATCAACTTCATTTTGAGCTTGTCCCACAAGGTTGCAATCACCAGTATGTCAGCTAAGGCTTCAGAACGTACGTATAGATGCTC
AGATGATTCACAAATGGCGTACTACAACAACTCGGTGCCTTTAGCAGAAAATGGACGGTTCTATATGATGCAAAATCATCTGGATGTTCACTACACATCT
TCAGGTGATGGGTCACAGAAAATTAGTTCCAATCCTCAAGTATTTGAAGCACAGTACTGCACACTCGAATCATCATCGGCAAATGGTGTTTATCCTACAC
AGAGCTCCACATCTTCTCATAGCATCTCCCCTATAAGTGGGAGCCCCCTGTCTCAGAATGATAGCCACTCATACCACACATATGATTCACCCCCAACTGC
TTCATGTGTTACCGAGATACCGGATTTCCAGAGTAAACTAAAGGAGCTAGAAAATGCAATTCTTGGACCTGAATTGGACATAGCCTTTGACAGCCCCGAG
AGCTTATTGCAAGCCAACCATCCTTTGAAACAAGATAACTGGAGACAGCTTCTGGGGAATTAACACAGGAGACTTGAAGCAGGTGATCATAGCATGCGGT
AAGGCTGTTGCTGCGAATGATATGTATGCGACAGAAACTATTGATATCTGAGCTAG
page-top