Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6017  (registered. 2012)
Contig Information
Length 954 bp
Clones alternative view 45 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 3
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 4
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 2
WH_XA Root 2
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242094384|ref|XP_002437682.1|| hypothetical protein SORBIDRAFT_10g000700 [Sorghum bicolor]
Score 336
Evalue 2.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6017
GGCTCCGCCGCCCTCATCCTCCTCCTCCCCGCCGCCGCCGCCACCTCGCCCCAGCCCAGCCCCCATCACCGGCGAAGATGAAGACCATCCTGGCGTCGGA
GACGATGGAGATCCCGGAGGAGGTGACCGTGAAGGTGTCGGCGAAGATGATCTCGGTGACGGGGCCGCGGGGGACGCTGACCCGCAACTTCAAGCACCTC
AACCTCGACTTCCAGCTGCAGGAGGGCGGGCGCAAGCTCAAGGTGGACGCCTGGTTCGGCACCCGCAAGACCATGGCCGCCATCCGCACCGCCATCTCCC
ACGTCCAGAACCTCATCACCGGGGTCACCAAGGGCTTCCGCTACAAGATGCGCTTCGTGTATGCTCACTTCCCCATCAACGCCTCCATCACCGCCGCCAA
CCGGGGCATCGAGATCAGGAACTTCCTCGGCGAGAAGAAGGTGAGGAAGGTGGACATGCTCGACGGGGTCACCATCTTGCGGTCCGAGAAGGTCAAGGAT
GAGATCGTCCTCGACGGCAACGACATCGAGCTCGTCTCCCGCTCCGCCGCCCTCATCAACCAGAAATGCCACGTCAAGAACAAGGATATCAGGAAGTTCT
TGGACGGTATCTACGTCAGCGACAAGGGCGCCATCAAGGAGGAGTAGAGTGCGAAAACCGTCCCAGAAGCCTTGTTTCTGCCTGCCGTGTTTCATCGTCT
TTGTGTCGTGGTTGTGATTTTGAACTTTCTCTAGACTGAATTTTGTAGTGGAGTTAATTAGGGATGCGCTATGCAACATGTTATCTTTATTATCCTACAT
ATTGTCACCGTGAGAATTGGTATGATGCTTATCTTCCCCTAAAGGTTGATGACTTCAGGTATTTGAAGTTAAAACAGGACATGAATGCGCTGCGTGTGCT
GTAGTGTTAAATGATTTGGTTATGCATTTACATTGCCTGCCTTCAAAAAAAAAA
page-top