Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6730  (registered. 2003)
Contig Information
Length 712 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Homology (BLAST) Top Hit hypothetical protein OsI_18605 [Oryza sativa Indica Group]
Score 104
Evalue 0.00691269
Total Hit Count 40
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6730
CCTCGTGCCGGAAGCACGTAAAGATGCAGTCGCAGCAGCGTTGGCTGTTCGAGAAAGCGCGGTTCGCTGTGCCGCGGCAAGTCGCCGTGCTGTGTTAGCA
GCTTCGACAGCTCGAAAGATCGCTTCCCGCTGTGAGGCAGCAGGTGGTGACGAAGCTATGGCGATGGCGAGAAAAGCTCGAGGAGCTGCTGACCGTTGTG
TTGCAGCGCGTGCCGATGCAGCCGCAGCTGGCGACGATGTTGCCGATGTTGCGGCCGGCCTCGCTCTGCCCCTTGCGGAAGCACCCGAGCTGTCCTTGCT
GTGCCGCTTGCACCAGCAGCAGCTGGTGCCAACCGGCCTGGCAAAGCCGCCGCCGACCTCGCTGTGGCCCTTGCCGAAGCTGGCCTTGCTGTGCCGCTTG
CCCATGCAGCAGCTTCGAAAGCTAGAGAAGCTGCCGCCGGTTGTGATTTGGCACTGGCCGATGCAATAGAAGATGGTGATAAAGAGTTTGTGGACAAGAT
GCGTGGTTGGCTCATGACGGTGGCCACGCTCTTTGTGGGCATAGCATTCCAAGCATTGCTGCATCCGCCAGACGGGATGTCCTTTGACATACTAGTAAGT
AAAAATGCTAGGAATTGGAAGGCAGGTCCTGGTGCTCCTTCGCCTGCTCCCAATCTCGCTCCATCTTCTGCATGGTTCCAATTTAAGTGCTCAGAACCAT
GCTAGCCCCCCT
page-top