Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6541  (registered. 2003)
Contig Information
Length 804 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Homology (BLAST) Top Hit hypothetical protein OsI_02229 [Oryza sativa Indica Group]
Score 121
Evalue 2.34351e-05
Total Hit Count 44
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6541
GGCAGAGGCATCCCCTTTCTCTCCCGGGCGACGCGACGGCGACGGCCGATTGCTGGCGGCAGAGAGGATGTTCCCCAAGATCAGCGGCAGCGTGACATGG
CGAGGGTCAGCGCGCTCAGTCGTACGCGGGCGGCGCTCACGAGCTCTTGGTCTCCGGCGGCTGCGGCGCGAGATCTTTGGTCTCCCGCGACGGCGGCGCG
AGCTATTGGTCGTCGGCTGCGGCGGCGCGAACTCTTGGCCGGATTGTGCCACGGCGAGGTCCTCCATTGTTGTCATGTCGAGCAACTAAAATCGCAAATA
TCCTGCATGTTGTGTGAAATTGCCCATGTCCCTTGGTTGTCTGATGATGTTACTTTTTGCTTGACAGATTCAGAGTTGTGTTAGATGTGTGATGAAACAG
TACCACACAAGATGCAGATTCTGATAACAGAAGCTAAACAAGCCAATATATTGTTCAATCTTGCATCATCAACACTATTATATGGTTGCCTGTGTATATC
TTGTCAGGACATGTCATCTCTGCAAACAAGTGCAGACTCAATCCTTCTCTGAACATACCATCAGCTAGTGCCCTCCCTGTGAACATTTTCAGGATCCAGC
AGCTGATGCAGAAAGGGCACAAAATCAAGGCAGTTCAGTAAGAAATATGTCTGTTGGAAACATCCCTATATATTGTTGTTGTTCCGTGATGTTGTACATT
GTAAACATATCTCCCTATTCAGGGATTTAGTTAGCCACGACTGACTAGCACGTTCGTGCACTCATGTACTTGGCTGAGATCAATACAAAAGTGGGTTTCA
TCAA
page-top