Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5927  (registered. 2012)
Contig Information
Length 885 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_f Spike at flowering date 1
Wh_SH - 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115440957|ref|NP_001044758.1|| Os01g0840200 [Oryza sativa (japonica cultivar-group)]
Score 340
Evalue 2.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5927
GTACTAACATAAGAATTGTTACTATAATCCAGATCCAAAATTTTTTCTTTAACCCACCAAATATAAATTTTTATTCTGTTAACTGGTACAGATTCAAGGA
CAAACAGGCCCACAATATGATGCTAGGAGAAGAGAACACGAGGGTTAAAAAGACACCCGTCACATACAAGCTAGAACGAACTAATCTTCAGCAAAAGCTT
GTTGCTGAAGAGGCCAGGCACAGTAAGCAACAGCAACAGTCTCGGAACAAGATGCTAACAGTAGCCCCTTGGAGCATATGATCTGGTGATCACACACAAG
ATAGACCTTCCATTACCTATGTCATAAGCAGGTCGTTCACTCCCAGGTGAGGAGGGCGCATGGAGACCCTAACTTCATGTTCTTCCGGCTCGTTTCCCCG
TTTGGGGACCATGATCTCAAGAACTGCAGCGGCCTCATCAAAGCATGCCTCAAGCTTGGCATCTTCGGGGATACGGGTGGCTAGAGGTATTTCACGGATG
AACTCCCCAGGAGGGCAGTGCTCGGGCATGGCGTCAGTGAGCTTGAAGACCCTGTCATGTCTCCTTATGTATGGCATCCGGGCTGTACTGACACAGAAGA
TTTTAACTATGCCATGAGTAGGAGTGTTCTTCCATGAAACTTTTACCCTCTGTTGATCGACAAATGGTAAGCTGACCATTATCAAGTAGCCCTGATCATC
CTCGTAAATGGACTTGGCAGCAGTTGCTGGCCCAGAGGCCTTCCTCATCACCCCGGTGAACTCGTGCATCCACGAAGGCTGCACTACCGACTGCATCTCG
ATATCTTGTTGTGTCCTCCCAGTGCAAGGGTTCAGAGGCAAGAAGCACTCCTCATCCATGGCATGTGGAAATGCCTCCTTCCTTC
page-top