Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5924  (registered. 2012)
Contig Information
Length 524 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig5924
GCACGAGGGAGCGCTCCTGCGTGTTCACAACCAAGATCCATATCTGCGGCCGTGAGATCAGATCAGATCAGATCGACCGAAGTCCAAGGAAGAAGGAGAA
GCGGCGGAGGATGGCGGACTGGGCACCGGTGGTGGTGGGGGTGGTGCTGTTCGTGCTGCTCTCGCCGGGGCTGCTGTTCGAGATGCCGGGGTCGCACCGC
CACGTCGACTTCGGCGGCCTCCACACCAACGGCAAGGCCATCTTCGTCCACACCCTCCTCTTCTTCGCCGCCTTCACCATCCTCACCCTCGCCCTCCACA
TCCACATCTACGCCGGCTAGACTGACACCCCATACCCCATAGATGCGCCATGTACTACCAATACTACTAGCTAGCTCTTGCCTGTCCGCGTGCTGTTCTC
TTGCTCGGTAAATCGATCCCCTCCATGTAATCAATCTGCTTGTAATCCAATCCCTGCCTGCAAATCTGGTGAAGAAGCGTGTTGATTGAAAAAAAAAACT
GTGCCTGTTTATTTAAAAAAAAAA
page-top