Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5767  (registered. 2003)
Contig Information
Length 534 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Homology (BLAST) Top Hit hypothetical protein OsJ_010652 [Oryza sativa (japonica cultivar-group)]
Score 261
Evalue 2.1222e-21
Total Hit Count 66
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5767
GCTTCATCAAAGCAGTCGAGTGCGAGCCGCGCACGACCTACGGACACCTGCTCACCTCCATGAGGACCATCATGCGCAACGGCGGCGGCAACTGCAACCT
GCAGGGCCCCGCCGGCGGCTGCATCCGCAAGGTGGCCAACTTCAGCGGGGTGGAGGAGCCCCAGCTGTCTTCTGCTTGCAAGTTTGACATCCACCGCGAG
CCGTTCTGCATGTAGAACCCGCGCCCGGGTTCGTCGTCGTTCTGCACTCGACGATTACCACCTACACGGCTAATCATCGACCGTATCGAGATAGCCGATC
AGTGGGATAAATAACTATGACGCTTTCTGCTAGTATGTGTGATAGCCGATCACCTCACCTGCCGCAATGCCATCCAGAATGAGCATAGCTCACACAAGGC
TCTGGAGGACCTCCTTCCTTAGCTGTATTGTACGTCTGTATGTACGTACCTCATTGTAATAAGGTTGTGGTGGTGTTGTGTGTCGTCTCATACGTACCCT
TATAAATAAATCAAGTTCTATGCCAAAAAAAAAA
page-top