Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5743  (registered. 2003)
Contig Information
Length 575 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Homology (BLAST) Top Hit putative exported uslfatase [Lentisphaera araneosa HTCC2155] >gi|149136625|gb|EDM25057.1| putative exported uslfatase [Lentisphaera araneosa HTCC2155]
Score 78
Evalue 4.40012
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5743
GCAACGAGCGAGCCAGCACTTTCTGCTCAGATCACCCGATGGGTTCCAGGTCCTGCTCCTACGTCTTCTTGCTCGGCCTTTGCTCCCTGCTGCTAGTGGT
GCTTTCAGGCCAGCGCACGCTAGCTCGAGACACTCCCGTGTCCACAGCAACGGCCTTGGCTCCATTTGTTCATGCGCCTGCCAAGGGCGACGCCGGCGGC
CACCGTGCTGATGTGGATAAGCCTCGAGTATCGGATGAGAAGCCAACAATAACCGGAATAATCTGGAGGCCCGTGCCTAAGATCCACTGCCCGTCCATCT
TTTGCGGTACCAAGGCTGCCACTGCCACTGCCCCTGCGGCAACGGCACATCCATGACAAGAAGAAGATAGAGTGGTGGTTCGCAATGTAATCATATGCAT
GTTTTCCTACCCTGGTTTTAGTAATTTAGATATATATGTATGTGTTCCACGAGTGTTGCAGCGTGCCTGCAAAGGCCTCTCGATGGATACTAGTAGTGCT
ATGGTAGCACGGTCGGGTTGTAGTTTCATTCATTGTATCTGTCGATCATGCAATTGGTTGCTGTCAAAAAAAAAA
page-top