Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5906  (registered. 2012)
Contig Information
Length 739 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_RDr Root of dessiccated seed 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_SP 1
WH_XA Root 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218194770|gb|EEC77197.1|| hypothetical protein OsI_15702 [Oryza sativa Indica Group]
Score 328
Evalue 4.00E-88
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5906
TTGCTCTTGCGTTGAAAATTAAAGCAAATTTTTAGTTTAGGGAACTACACCCCGAAGCTCTGAACGAAAACGGGACAAACGCGTTATCATATCCTCAACT
CAAATCTCCGTCCTTCTCAGGACGCAACTCTTTGTATCAGTCAAAAATTTGCACGGTATTATTTTCCAGACAAGCACGAGGCACTTGGCAGCAAAGGAGA
TCGGGCGCATGGGGCTTATATGTCAAGGAGCAGCCTCCGGGGGTCCTCGACGACGTCCTTGATGCGGCGCAGGAAGTAGACGGCTTCTCTGCCGTCGATC
AGCCTGTGGTCGTATGTCAGCGCGAGGTACATCATGGGCCTGGCGAGGATGCTGCCGTCCACGACCACGGGGCGTTGCACGATGGAGTGCATCCCAAGAA
TCGCTGACTGTGGGGGGTTGATGATGGGCGTGCTAATAAGGCTTCCGTAGACACCACCGTTGGAGATGGTGAATGTTCCTCCCGCCATCTCGTCAATTGA
CAGCGCCCCCTCAGTAGCCTTCTTTGCAAGGTTGTTTATCCCTTTCTCGATGTCAGCAAAGTTCATTGTATCAGCATCTCGGATAACCGGCACCACAAGA
CCCTTGGAAGTGCCAACAGCAACACTAACGTCGACATAGTCTCTGTATATGATGTCATCGCCGTCAATGACAGCATTCACAATTGGCTGGTTCTGCAGTC
CAGAAACAGCAGCCTTGACAAAGCAAGACATCAGACCTA
page-top