Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5904  (registered. 2012)
Contig Information
Length 933 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_f Spike at flowering date 2
Wh_r Root 1
Wh_RDr Root of dessiccated seed 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115444865|ref|NP_001046212.1|| Os02g0198900 [Oryza sativa (japonica cultivar-group)]
Score 315
Evalue 4.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5904
CAGGAAAGATATGCGATACTGAAAGAAAGTCTTATTCTAGAACGCCAACGTAGCAACTAAATATCTAGTTCGCATCTCGCTTTCGTTACCTGTCACAAGT
AAACCATTTCCTCCAAAAGTATAGAGATCCTCAGACCTGGAATGCTCCATCATGCTAACAAAATCAGAAGAAAGAAATAAGGATTGCAGTGTTCAGAATT
TGATCCTTCACTCCATCACAGCAACACCACCAGCTGCCTTGATCTTTGCGATGATTGCTTCCGCTTCCTCCTTCGTGAGTGACTGCTTCAGAATAACAGG
GGCCTTCTCCACCAACTCCTTCGCATCCTTCAGCCCCAGATCGGTAAATGTTCTGATCTCCTTGATAATCTTGATCTTTGCAGCAGCCTCAAATTTCTCC
AACTTGACATCGAATACTAGCTTCTCAGCCTTTTTCTCTTCAGACTTTGCGGCGCCAGCCCCTGCACCACCTTGAGAACCCATACTAAAACCCTGGCCAG
AAATTGCCTGTGGTGCTGGCTGGTTCAGTCTGAGAAGGAGAGCTGGAGCTATCTGCTTGATCTCCTCAGGAGGAAGAGCGGCAATGCGGTCCGCTAGACC
CACAACTTTCTCTGATGCTGGTGGCATAGGCCCATATGGGTCATAGACTTCAGGATATTTGTACCTCTTAGCACCAGTGTCTTTTGCAGCCTCGGTGCTG
TGCAGACGAGCCAAAACTACTGAAAGTCGACTTGTGGATGACTGTCTTGAACAACATAGTCGTCTTGCTATGGAAGACAAACTCATCCTACCGTCAACTA
GGTATTGGCACAAAAATATAGCAAAGGAAGGAGAAGAAACTAAAGATTGGCTGCCCGCGCCGGCCGCCGGAGAAGGGGCGCGAGATCTGGCGCGCCGCGG
AAACGAAGAGGAGAAAGGGTCTCTGGCGGCTGG
page-top