Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5504  (registered. 2003)
Contig Information
Length 529 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit hypothetical protein OsJ_034385 [Oryza sativa (japonica cultivar-group)]
Score 753
Evalue 1.85151e-78
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5504
GTTCAAGAGGATGATAGACCGGGGGCTGAAACCAGACGTGGTCTCCTATGGAGCATTGCTCAGCGCGCTCGAGAAGGGCAGGCTCTACGACGAGGCGCTG
AGGGTCTGGGAGCACATGCGCAAGGTCGGCGTCGACCCGAACCTGCACGCGTACACGATCCTGGCGTCCATTTACGCCGGCAAGGGTGACCATGACAAGG
CGGACGCAGTTCTTCGGGACATGCTGTCCGCGAAGATAGAGCCGACCGTTGTGACCTTCAACGCGATCATCACCGCTTGCACGAGGAGCGGCGCGGCCTT
CGAGTGGTTCCACAGGATGAAGATGCACAACGTCGAGCCGAGCGAGGTCACATATCAGGTGTTGATCGAAGCCCTTGTGCAAGACGGTAAGCCCAAACTT
GCCTATGAGATGTACATCAGGGCCTCCAACCAAGGGCTCAAGCTCTCTGCAAAGTCGTATGACACCGTAGTGGAGGCGTGCCAAGATTATGGCTCTCTTG
TTGATCTCAATACTCTGGGTCTTCGGCCT
page-top