Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5893  (registered. 2012)
Contig Information
Length 937 bp
Clones alternative view 61 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_yd Spikelet at late flowering 2
Wh_SH - 19
Wh_KMP Shoot grown under continuous light 8
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VHS Shoot with heat shock treatment 5
Wh_VWD Shoot grown with dessication 6
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XF Seedling, infected with leaf rust 6
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226502967|ref|NP_001142284.1|| hypothetical protein LOC100274453 [Zea mays]
Score 459
Evalue 3.00E-127
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5893
TTTTTTTTTTAAGCAGAAGAACAGAGATGCCTTGATTAATCTGAGAAAATAGCCAGATATTACACAAACACCATCTTAGTGTACACACACCAACTCCTCA
TCTCGACTCGCCCTCACATGCAACATCTATCAGTCCGGACTACTCAATCTCACAACGGGAAGAAGCAGAGATCGACGACGACACACATGCAGCAGCATCC
ATCAGCCATGAAGTTGTCGGCCTAGAGGTTGAGCTGACCGCGCTCACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCAGGCGTTGTTGTTGACGGGGTC
GGCGAGGTGGTCGGCGAGGTTCTCCAGGGGCCCCTTGCCGGTGACGATGGCCTGCACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTG
ATCTCCTTCACCTTGAGCTCCGCGAACGCCTCGGGGTCCTCGGCGAGGCCCAGGGGGTCGAAGCTGCCGCCGGGGTAGAGCGGGTCCACGATCTCGCCGA
GCGGGCCGCCGGCGACGCGGTAGCCCTCCACGGCGCCCATGAGCACCACCTGGCAGGCCCAGATGGCGAGGATGCTCTGCGCGTGCACCAGGCTGGGGTT
GCCGAGGTAGTCGAGGCCGCCCTCGCTGAAGATCTGGGAGCCGGCCTTGAACCACACGGCCTCGCCGAACTTGACGCCGTTGCGGGCGAGCAGCTCCGGG
AAGACGCAGCCGAGCGCGCCGAGCATGGCCCAGCGGCAGTGGATCACCTCCAGCTCCCGGTTCTTGGCGAAGGTCTCGGGGTCGGCGGACAGGCCCGCGG
TGTCCCAGCCGTAGTCGCCGGGGAACTCGCCGGTGAGGTNNNTCGGCGGGTCGCCGGAGAGCGGGCCGAGGTAGAGCACGCGGNNGGAGCCGTACCACGG
GCTGCTGGACGCCGCCACCTTGGGCTTGCCCGCCGTC
page-top