Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5889  (registered. 2012)
Contig Information
Length 1278 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_SH - 8
Wh_KMP Shoot grown under continuous light 2
Wh_VWD Shoot grown with dessication 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|288904218|gb|AAZ67145.2|| geranylgeranyl hydrogenase [Triticum aestivum]
Score 599
Evalue 2.00E-169
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5889
TTTTTTTTTTCCCACCAAAATCAACATACTGTCTGGGTGGTGTTGACCCGTTTCATTCCATTTCTCGTTCGTGAGAACAAACATGAACAAAAAGTTGAAA
CCTTTAGTTTATACTACATTCATTCACATATCGAATATTGGCGTGCTTCAACAATCCAGACGAACTGCTCTGAAGTCTGAACATCACCGTGCATGCGTAC
GTTGTACTACAAGAAAACCGGACAGGATCGACCAAGACACGACCTCTCGATCGACGCCATTACCTTATTCTCATCTCCTCTGCCTCAAATCCGTTCGATC
AGCCGCGGATCTCTGCTATACCGACCGATCCGCCGCAGCTTCGAGCGACCCAAGCAGGCTGTCAGGAACGTTTCCGGCGGGTCGGCGATCACAAGGTGAG
CTTCCCCATCTCCCGGCGCAGCGCGGTGGCCCTGACGAGGCTGCCGATGGTGTTGACGGCGAGCTTGATGTCCTCGATGGGGTTGCCCGGCACGACGCGC
TTGTAGAGGTAGCTGTCGAAGGTCATCCGCTGCACGTAGTCGTCGGCGCACATCTCCACGAACGCCTCCCGCGCCGCGTTGGAGCGGTAGAACACCTTCT
GCAGGATGTCCAGCACCTTGTACGTCGGCCAGTAGAGCCGGTCGAACTCCGCCAGGTACTTGCGCAGGTCGCTCTCGTCCACCAGCCGCGTCCCGTTCGC
CGACCCGGCCACGATCGCCTCCGCGCACATCCGCCCGCTCTTCGCCGCGAAGTAGATCCCCTCGCCGGAGCACTTGGTCACGTACCCCGCCGCGTCGCCC
ACCAGCGTCACCCGCCCCGACACCCTTTTGGGCCTGGGGTGCTCGGGGATGGGGTGAGCCTCGACGCGGATGATCTTGCCGCCCTCGATCTTGTCCTTGG
CGCGGAGGCGGGTAGCGGCCTGGAACTTCTTGATGTCGGCCTTATGGGTGACGGTGCCGGTGCCGACGGCGACGTGGTCACACTTGGGGAACACCCAGCC
GTAGAAGTCGGGGGACACGTCGTCGCCGACGTACATCTCGGCGCGCTCCTCGTAGTAGCGCATCTTGTCGTCGGGGATCTTGACGCGCTCCTGGAACGCG
ATGGCGTACTCGTAGTCGCCGGCGCCCATGTCCTTGGCCACGCGGGAGTTGGCGCCGTCCGCGCCCACGATCGCGTCCACCTCGAACGAGCGCTTCTCGC
CGCCCACCTTGCCGTTGGAGCTGTCGTAGTGGTTGTAGTGCACCGTGTATGTGCCGTTGCGCTCCTTGGGCGCCTCAT
page-top